1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jasenka [17]
3 years ago
8

The variety of life across the biosphere is called

Biology
1 answer:
marysya [2.9K]3 years ago
6 0
I think biotic but im not sure
You might be interested in
Which of these is the lowest sub group: <br> A: kingdom <br> B: order <br> C: genus <br> D: species
dexar [7]

<u>In order, the sub groups go:</u>

<em>life</em>


<em>domain</em>


<em>kingdom</em>


<em>phylum  </em>

<em>class</em>


<em>order</em>


<em>family</em>


<em>genus</em>


<em>species</em>


<em>Therefore, D (Species), is your answer.</em>


3 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Plucking is caused by_______. <br> Ice <br> Water <br> Wind <br> Sand
makvit [3.9K]
Plucking is caused by ice.
3 0
3 years ago
Read 2 more answers
What did Many nations agree To do To help deal with climate change
Ilia_Sergeevich [38]

Answer:

Build homes and stable environments for people to live in during the bad weather.

7 0
3 years ago
Please help me How do water particles in a wave move?
Anton [14]
Water waves are an example of waves that involve a combination of both longitudinal and transverse motions. As a wave travels through the waver, the particles travel in clockwise circles. The radius of the circles decreases as the depth into the water increases. The animation at right shows a water wave travelling from left to right in a region where the depth of the water is greater than the wavelength of the waves. I have identified two particles in orange to show that each particle indeed travels in a clockwise circle as the wave passes.
5 0
2 years ago
Other questions:
  • What are four resources that can be obtained from the ocean?
    10·1 answer
  • Which part of a phospholipid is hydrophilic
    14·2 answers
  • What cellular components do some bacterial cells have that make them powerful pathogens? explain your answer. 2. why are penicil
    10·1 answer
  • Doing a presentation on your favorite device is a good practice for evaluating technology for the workplace. True or False?
    7·1 answer
  • Why is diffusion important to cells?
    9·2 answers
  • if you were to make a pitcher of sweet iced tea, which ingredient would represent solute? Which ingredient would represent the s
    9·1 answer
  • How does the molecular clock work?
    11·2 answers
  • When Engelmann exposed photosynthetic algae to light in the presence of aerobic bacteria, he found that some wavelengths of ligh
    9·1 answer
  • Humans evolved in the Eocene period.
    5·1 answer
  • Complete Homework Questions from Pages 340-350 of California Experience Biology the Living Earth
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!