1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luba_88 [7]
3 years ago
12

What is the term for organisms that consume other organisms for food like animals, some bacteria, and fungi?

Biology
2 answers:
Aleks [24]3 years ago
4 0

Answer:

Heterotrophs

Hope this helps!

ycow [4]3 years ago
4 0
Answer: Heterotrophs


Why : A heterotroph is an organism that eats other plants or animals for energy and nutrients. The term stems from the Greek words hetero for “other” and trophe for “nourishment.” Organisms are characterized into two broad categories based upon how they obtain their energy and nutrients: autotrophs and heterotrophs.
You might be interested in
Organisms that cause nausea, vomiting, and diarrhea usually enter the body through which portal of entry?
yarga [219]

<span>Cytokines are tiny protein hormones that normalize immune responses and facilitate cell-to-cell communication. The disproportionately high levels of cytokines released by T cells enter the bloodstream and increase the number of symptoms, including fever, biliousness, vomiting, diarrhea, and sometimes tremor. Superantigens which includes staphylococcal toxins that may lead to food poisoning and toxic shock syndrome.</span>

7 0
3 years ago
What is the synonym for hypothisize
viva [34]

Answer:

contemplate

Explanation:

ask in english next time

3 0
2 years ago
Read 2 more answers
The two alleles for each trait must separate when gametes are formed. Therefore, a parent passes on at random only one allele fo
Orlov [11]
Mendel's Law of Segregation states that every organism has two alleles per trait and that these alleles separate during meiosis, so each gamete gets one allele.
7 0
3 years ago
Which is the correct answer?
sp2606 [1]
Decrease the second one
7 0
3 years ago
List 3 substances that contain carbohydrates tested in the laboratory​
N76 [4]

Answer:

starch, cellulose, and glycogen

8 0
2 years ago
Other questions:
  • Explain how weathering erosion and deposition happen in our enviroment
    9·1 answer
  • A$55.00 purse is on sale for $30.25
    13·2 answers
  • One function of the hematic system is to _____.
    10·1 answer
  • The ocean absorbs carbon dioxide directly from the atmosphere. How does CO2 absorption affect the ocean?
    8·1 answer
  • Things too small to be seen with other microscopes may be viewed with an
    11·1 answer
  • Do you think you can help?​
    13·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following is not a potential benefit of the Human Genome Project:
    5·1 answer
  • In thinking about the asexually reproducing creatures in this simulation, what advantages did their reproduction style have in e
    13·1 answer
  • Explain why the deletion or inactivation of the SH3 domain in Src would have an oncogenic effect while the mutation of Tyr 416 t
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!