1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
beks73 [17]
2 years ago
7

I NEEED HELP AS QUICK AS POSSIBLE!!!

Biology
2 answers:
AysviL [449]2 years ago
5 0

Answer:

the right answer is D

anygoal [31]2 years ago
4 0

Answer:

D

Explanation:

Plants take in Co2 and release o2, the carbon stays inside them and when animals eat them they consume the carbon.

You might be interested in
Which disappears more rapidly from a population, a deleterious dominant allele or a deleterious recessive allele?
Allisa [31]

Answer:

Selection is a directional process that leads to an increase or a decrease in the frequency of genes or genotypes. Selection is the process that increases the frequencies of plant resistance alleles in natural ecosystems through coevolution, and it is the process that increases the frequencies of virulence alleles in agricultural ecosystems during boom and bust cycles.

Selection occurs in response to a specific environmental factor. It is a central topic of population and evolutionary biology. The consequence of natural selection on the genetic structure and evolution of organisms is complicated. Natural selection can decrease the genetic variation in populations of organisms by selecting for or against a specific gene or gene combination (leading to directional selection). It can increase the genetic variation in populations by selecting for or against several genes or gene combinations (leading to disruptive selection or balancing selection). Natural selection might lead to speciation through the accumulation of adaptive genetic differences among reproductively isolated populations. Selection can also prevent speciation by homogenizing the population genetic structure across all locations.

Selection in plant pathology is mainly considered in the framework of gene-for-gene coevolution. Plant pathologists often think in terms of Van der Plank and his concept of "stabilizing selection" that would operate against pathogen strains with unnecessary virulence. As we will see shortly, Van der Plank used the wrong term, as he was actually referring to directional selection against unneeded virulence alleles.

4 0
2 years ago
Which of the following is a common renewable resource found in deserts
frez [133]

Minerals

Explanation:

Minerals can be found in the cactus and ground and are very resourceful

3 0
2 years ago
Why do you think that some vaccines, such as the flu vaccine, need to be given every year?
DochEvi [55]

Answer:

Because flu viruses evolve so quickly, last year's vaccine may not protect you from this year's viruses. New flu vaccines are released every year to keep up with rapidly adapting flu viruses.

5 0
3 years ago
Read 2 more answers
Charles washes his hands every time he passes either the bathroom or the kitchen sink. Before he goes to bed at night, he checks
FromTheMoon [43]

In reality this is way too little information to go on, and it would be irresponsible to make any assumptions about an individual based on what was provided here alone, but for the sake of merely answering a High School Bio question:

the answer is  A.  OCD.

3 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • A grass starts with 30,000 kJ of energy. How much energy would a cheetah acquire after it ate a zebra that consumed the grass?
    11·2 answers
  • The clinic nurse has a prescription to apply a transdermal scopolamine patch to a client who gets motion sickness and is going o
    5·1 answer
  • Suppose you were in charge of sending an unmanned space probe to a new planet in search of life. The probe would be able to coll
    10·1 answer
  • 20 points
    14·2 answers
  • Briana is listing some pros and cons of recycling bottles. What can she list in the “Con” column? Pro Con Uses less energy to ma
    11·1 answer
  • Why are ameobas animal like protists likely to use endocytosis
    14·1 answer
  • Write out the acronym<br>for DRY MIX below:<br><br><br><br>I NEED HELP​
    6·1 answer
  • Which type of plant is a fern?
    14·2 answers
  • What is NOT an example of nitrogen fixation?
    9·2 answers
  • Part b zoom out until you can see other constellations that surround ursa minor, such as ursa major (the big dipper) and cassiop
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!