Lipids are water insoluble biomolecules that in the form of phospholipids, play an important part of the cell membrane structure and function.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
It depends entirely on an equation, certain equations are meant to confuse you with numerous answers so taht you have to narrow it down, some only have one or a few. It really depends on the type of problem
Chromosome mutations can result in changes in the number of chromosomes in a cell or changes in the structure of a chromosome. Unlike a gene mutation which alters a single gene or larger segment of DNA on a chromosome, chromosome mutations change and impact the entire chromosome. Key Takeaways: Chromosome Mutations
