1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
14

I will give brainiest how does a orange get its color

Chemistry
2 answers:
marysya [2.9K]3 years ago
7 0

Answer:

by mixing red and yellow

Explanation:

anygoal [31]3 years ago
5 0

Answer:

Either the sun or by mixing red and yellow together because they make orange.

Explanation:

Brainliest pls

You might be interested in
Compared to the nonmetals in Period 2, the metals in Period 2 generally have larger
konstantin123 [22]
The answer is atomic radii; the size or radii of an atom increases from left to right, versus the ionization energies and electronegativities of atoms which increase from right to left.
6 0
3 years ago
How many moles are in 3.0g of A1203?
vfiekz [6]

Answer:

0.065 moles

Explanation:

4 0
3 years ago
PLEASE HELP
Sergio [31]

Answer:

C. The Protons

5 0
3 years ago
Read 2 more answers
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
After mitosis, you have 2 cells that are the same as the parent cell. Why is it that your first cell was not the same as your pa
ladessa [460]

Answer:

During MITOSIS, the parent, diploid (2n), cell is divided to create two identical, diploid (2n), daughter cells. ... After cytokinesis, the ploidy of the daughter cells remains the same because each daughter cell contains 4 chromatids, as the parent cell did.

4 0
3 years ago
Other questions:
  • When atoms are bonded together are they stable or unstable?
    15·1 answer
  • Calculate the molarity of 80.0 ml of a solution that is 0.92 % by mass nacl. assume the density of the solution is the same as p
    14·1 answer
  • What is the volume of a rectangular object whose dimensions are 5.54 cm, 10.6 cm, and 199 cm?
    15·2 answers
  • If 200.0 g of copper(II) sulfate react with an excess of zinc metal, what is the theoretical yield of copper?
    6·2 answers
  • List other countries that have tried recycling sewage for drinking water. Recall any evidence of health effects.​
    5·1 answer
  • 6/10
    9·1 answer
  • Is oxygen a beginning substance or ending substance?
    6·2 answers
  • PLEASE HELP!!!<br><br> What are 3 types of heat energy transfer?
    6·2 answers
  • Wetlands are able to remove nutrients and chemicals from water as the water flows through the area. A developer is planning to d
    14·1 answer
  • What is the strongest type of intermolecular force between solute and solvent in each solution? (a) CH3OCH3(g) in H2O(l)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!