1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fgiga [73]
3 years ago
5

Fluvial Processes 1. What type of drainage pattern is shown in the following image?

Biology
1 answer:
r-ruslan [8.4K]3 years ago
7 0

Answer: Dendritic pattern

Explanation:

The drainage pattern that is shown in the picture above is referred to as the Dendritic pattern.

Drainage Pattern simply refers to the pattern that is formed by lakes, rivers, streams etc in a drainage basin. It should be noted that a dendritic drainage patterns look like the branch of a tree that has lots of twigs and they are usually formed in areas that has flat bedrock such as shale. Since the above diagram looks like the description here, the answer is a dendritic pattern.

You might be interested in
The geese and the humans are in competition for something in this area.
Karo-lina-s [1.5K]
Space, is what i would guess.
4 0
4 years ago
How are plants different from animals
ehidna [41]

Answer:

B. Plants can make their own good

3 0
3 years ago
Read 2 more answers
By age 65, what percentage of adults are grandparents? 75 80 85 90
frutty [35]
85% of adults are grandparents by age 65. This estimation has been made in the U.S. from the surveying of the elderly. So, the correct choice is the third option: 85. 

Let me know if you need further info. :)

                - Dotz
7 0
3 years ago
1. What animals do you think<br> Darwin was describing in his<br> entry?
AveGali [126]
Is there a picture to go with this?
7 0
3 years ago
Read 2 more answers
EASY POINTS!
vodomira [7]
B) Bb x Bb because to have blue eyes they need to get the trait from both parents
8 0
3 years ago
Other questions:
  • A slug is an example of what animal group of
    6·2 answers
  • The site of photosynthesis in a plant cell is the
    14·1 answer
  • A student notes that an individual has attached earlobes, a recessive trait in humans. A cell is taken from this individual, and
    8·1 answer
  • Humans are the selective agent in which type of procces, artificial selection or natural selection
    15·1 answer
  • What would influence a species' physical appearance
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • PLEASEEE ANSWERR !!!​
    5·1 answer
  • What is the monomer (building block) of proteins?
    12·2 answers
  • The kind of life cycle seen in flowering plants is:
    11·1 answer
  • What do wolves eliminate from the population?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!