1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodka [1.7K]
3 years ago
6

Using the diagram below, identify the ONLY portion of the nucleotide that is not the

Biology
1 answer:
Fantom [35]3 years ago
8 0

Answer:

phosphate

Explanation:

You might be interested in
Which evolutionary mechanism changes genotype frequencies but does not change allele frequencies?
Montano1993 [528]

Assortative mating is the evolutionary mechanism that changes genotype frequencies but does not change allele frequencies.

Assortative mating is the type where two individuals mate with each other on the basis of their similarities and dissimilarities. This is a different phenomenon than the random mating that occurs by chance. Assortative mating can be used to increase the number of organisms of a population containing a certain trait.

Allele is the alternative form of a gene. It arises due to mutations. A gene can have more than one types of alleles. However, usually a gene only has one allele. The alleles are found at the same location of the homologous chromosomes.

To know more about assortative mating, here

brainly.com/question/28494397

#SPJ4

6 0
1 year ago
Which of the following serve as antibodies?
Vlad [161]
Proteins serve as antibodies.
3 0
3 years ago
Read 2 more answers
The process by which an individual seeks out environments that correspond to their genotypic characteristics is described as the
Lilit [14]

Answer:

Active genotype - environmental effects

Explanation:

There are primarily three types of co-relation between genotype and environment which are as follows –  

a) Passive genotype –environment effect – This depicts the relationship between the genetic characteristics acquired by a child from his/her parents and the environment in which he/she is raised.  

b) Reactive genotype –environment effect – This represents a relationship between genetically acquired behaviour from parents and the reaction corresponding to such behaviour.  

c) Active genotype –environment effect – This represents a relationship between genetic tendency of an individual and the environment condition selected by an individual .

5 0
4 years ago
Some carbohydrates are classified as reducing sugars due to their ability to reduce other reagents. What features of a carbohydr
julia-pushkina [17]
  • An aldehyde exists in chain form.
  • A ring-shaped hemiacetal exists.

Hemiacetal:

  • A reducing sugar is one that reduce other compound and oxidized itself. A sugar can be called as reducing sugar if it has an aldehyde group in the open chain form or hemiacetal group in ring form.
  • The hemiacetal consists of a hydrogen bonded to a "R-group," an alcohol, an ether, and a carbon. When an aldehyde and an alcohol interact, the hemiacetal is created.
  • The chemistry of carbohydrates revolves around the interactions between hemiacetals and hemiketals. Carbohydrates are made up of long chains of the sugar units known as monosaccharides, much like proteins are long chains of amino acids and DNA and RNA are long chains of nucleotides.

Learn more about hemiacetal here brainly.com/question/2983055

#SPJ4

4 0
2 years ago
Of the five human activities discussed in this reading, which is most and least detrimental to natural environments?
Komok [63]

it says "discussed in the reading"..which reading??

8 0
3 years ago
Other questions:
  • During a biochemical reaction using an enzyme to break apart a substrate, which is true of the moments when the substrate and en
    10·1 answer
  • Why would over-inflating the cuff of the sphygmomanometer be a problem for the patient?
    14·1 answer
  • What are the benefits of scientists using the metric system worldwide?
    7·2 answers
  • The pigmented portion of the eye that has a rounded opening through which light passes is the ________.
    9·2 answers
  • Which of the following are not characteristics of the plasma membrane? Select all that apply. cellulose phospholipids and protei
    13·2 answers
  • Number the steps from when the stimulus received to when the body reacts​
    5·1 answer
  • Which is NOT part of cell theory?
    5·1 answer
  • The graph below shows which wavelengths, in nanometers (nm), and corresponding colors of light are absorbed by the plant molecul
    9·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • A cup is surrounded by air in room temperature
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!