1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svp [43]
3 years ago
15

O

Biology
1 answer:
Lostsunrise [7]3 years ago
8 0

Answer:

Local effects of volcanic eruptions

Explanation:

Lava flows, volcanic landslides, mudflows, and ash flows (nuees ardentes) generally result in total obliteration of any ecosystem in their path. ... Volcanic ash weathers rapidly and releases plant nutrients.

You might be interested in
All these belong to the second line of defense except
babunello [35]

Answer:

Option D, Gastric Juices

Explanation:

The second line of defense is a non specific defense mechanism in which no specific individual is targeted but all invaders are killed in general way. Some common mode of second line of defense are - Phagocytic cells (white blood cells), inflammatory responses, macrophage system etc. The second line of defense comes into action when the invader has surpassed the first line of defense which include either physical barrier like skin, mucous membrane, hair, cilia etc. or chemical barriers like gastric juices, saliva, Hyaluronic acid etc.

Hence, gastric juice does not belong to second line of defense.

Thus, option D is correct.

6 0
3 years ago
Nobel, who has terminal cancer, has been in a depressed state for several weeks. the most effectve way to help him move out of t
Stells [14]

The right answer is have a frank, open discussion with him about his feelings.

The combination of a depressive disorder with a serious physical illness such as cancer can make the identification and treatment of depression more difficult. Indeed, the symptoms of depression may be underestimated and attributed to the other disease.

4 0
3 years ago
When the protein gramicidin is integrated into a membrane, an H+ channel forms and the membrane becomes very permeable to proton
Naddika [18.5K]

Answer:

The electron transport chain may be defined as the sequential steps of the oxidation and reduction of the cytochromes. The electron transport chain is important for the production of ATP.

The gramicidn protein is an ionophoric antibiotic that can affect the electron transport system. The electron transport rate, oxygen uptake and proton pumping remains the same as more hydrogen ions will enter in the cell.  But the ATP synthesis rate might decrease and completely stop by using gramicidin.

8 0
3 years ago
Why are bacteria a necessary part of the nitrogen cycle
USPshnik [31]
They help convert nitrogen to nitrate which is usable by living beings. (Living beings can't use regular nitrogen)
7 0
3 years ago
Read 2 more answers
A mutation that involves a single nucleotide is called.
alina1380 [7]

Answer:

Point mutations are a broad category of mutations that describe a change in a single nucleotide of DNA, such as a substitution for another nucleotide, deletion of a nucleotide, or insertion of a single nucleotide into the DNA, resulting in DNA that differs from the normal or wild type gene...

or you can say:

Point mutations are a large category of mutations that describe a change in single nucleotide of DNA, such that that nucleotide is switched for another nucleotide, or that nucleotide is deleted, or a single nucleotide is inserted into the DNA that causes that DNA to be different from the normal or wild type gene ...

8 0
3 years ago
Other questions:
  • What do you think stupor mean
    12·1 answer
  • In general, what plant structure would have the most chloroplasts?
    5·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • G Which of the following statements is false?
    15·1 answer
  • What is combustion and how does it affect the carbon cycle?
    6·2 answers
  • For each scenario in the attached handout write down whether the scenario is positive or negative feedback.
    11·1 answer
  • Write the consenus sequence for the following nucleotide sequences AGGAGTT AGCTATT TGCAATA ACGAAAA TCCTAAT TGCAATT TGCAATT
    10·1 answer
  • Humans may have type O, A, B, AB blood. This blood<br> type is a trait that is determined by?
    5·1 answer
  • I need some help....
    8·1 answer
  • What does hydroelectric power do?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!