1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondaur [170]
3 years ago
15

4. Which of the following statements best describes how the traits of an organism are determined

Biology
1 answer:
butalik [34]3 years ago
6 0

Answer Choices:

DNA provides the energy needed for an organism to grow and function

DNA is copied into mRNA, which controls cellular functions

DNA codes for proteins, which allow an organism to grow and function

DNA unzips and each strand codes for a different amino acid

Answer:

DNA codes for proteins, which allow an organism to grow and function

Explanation:

DNA provides the energy needed for an organism to grow and function  - this is false. DNA does not provide energy. A molecule called ATP, mostly produced by cellular respiration, provides energy for the cells to grow and function.

DNA is copied into mRNA, which controls cellular functions  - this is false. While it is true that DNA is copied into mRNA, mRNA does not directly control cellular functions. Instead, mRNA is translated into proteins.

DNA codes for proteins, which allow an organism to grow and function  - <u>this is true, as indicated above, DNA is transcribed to mRNA which is translated into proteins. Proteins carry out essentially all the functions in the cell</u>

DNA unzips and each strand codes for a different amino acid - this is false, DNA is transcribed into mRNA. Each mRNA codon (three bases) codes for a different amino acid

You might be interested in
What is a process in the human body in which there is evidence of the cell cycle at work?
mina [271]
Skin reproduction, which occurs over and over

5 0
3 years ago
According to the cell theory, cells come from ________________. spontaneous generation photosynthesis other living cells cellula
grigory [225]

cells come from other living cells


4 0
3 years ago
A student is studying a cell and can clearly see that is has ribosomes and mitochondria. Which statement best describes how the
zmey [24]
Both plants and animals have these. It is a eukaryotic cell.
6 0
3 years ago
Evolution of true cells was made possible when genetic information could be passed on. How is the genetic information passed on?
LenaWriter [7]
The answer would be A.DNA
4 0
2 years ago
Builders who understand landscape ecology are mindful of what aspects of the environment?
dybincka [34]
A) local ecosystems hope it helps
5 0
3 years ago
Read 2 more answers
Other questions:
  • Selling food on a global market decreases the sustainable use of the land because crops cannot be rotated as easily. what is ano
    6·2 answers
  • Do arthropods have three embryonic germ layers
    13·1 answer
  • A group of organisms which live together in an area is called a(n) ____.
    15·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Explain how the Earth’s rotation and revolution about the Sun affect its shape and is related to seasons and tides.
    9·1 answer
  • Mutations in a gene occur at a rate of one nucleotide every 10 million years. The gene sequence differs by 6 nucleotides between
    7·1 answer
  • Structurally, DNA and RNA nucleotides are similar, although their three basic components differ slightly. One way DNA and RNA di
    9·1 answer
  • What circumstances led to the reintroduction of the wolves to the park
    10·1 answer
  • What is a climate hazard
    12·1 answer
  • Fill in: Name the organelle or organelles that perform each of the following functions. A. _____________________ convert sunligh
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!