1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka-Z-Leto [24]
3 years ago
15

Herbicides are chemicals used to kill or inhibit the growth of unwanted plants and weeds. Many herbicides work by blocking elect

ron carriers, or reducing their ability to carry electrons, in the light dependent reactions. One such chemical is DCMU (3-(3,4-dichlorophenyl)-1,1-dimethylurea). DCMU is an algaecide and herbicide that works by blocking the electron binding site of plastoquinone. This means that photosystem II is unable to transfer electrons from the splitting of water to plastoquinone. This effectively shuts down the linear flow of electrons in the light dependent reactions. a) Identify the molecule produced in the light dependent reactions that would be most affected by the shutting down of linear electron flow. b) Justify your reasoning with an explanation. c) Connect how the molecule affected in part (a) is used in the Calvin cycle. d) Describe what would effectively happen to the Calvin cycle as a result of exposure to DCMU
Biology
1 answer:
e-lub [12.9K]3 years ago
3 0

Answer:

Oxygen.

Explanation:

Oxygen molecule that is produced in the light dependent reactions. This shutting down of linear electron flow greatly affected the production of oxygen. Photosystem II gains replacement electrons from splitting of water molecules into hydrogen ions (H+) and oxygen atoms so if the electron flow is disturbed then oxygen production is greatly affected.

You might be interested in
How do scientific research impact scientific thought ?
creativ13 [48]

Answer:

Until the past decade, scientists, research institutions, and government agencies relied solely on a system of self-regulation based on shared ethical principles and generally accepted research practices to ensure integrity in the research process. Among the very basic principles that guide scientists, as well as many other scholars, are those expressed as respect for the integrity of knowledge, collegiality, honesty, objectivity, and openness. These principles are at work in the fundamental elements of the scientific method, such as formulating a hypothesis, designing an experiment to test the hypothesis, and collecting and interpreting data. In addition, more particular principles characteristic of specific scientific disciplines influence the methods of observation; the acquisition, storage, management, and sharing of data; the communication of scientific knowledge and information; and the training of younger scientists.1 How these principles are applied varies considerably among the several scientific disciplines, different research orgrecently, a few research institutions have developed guidelines for the conduct of reserch

4 0
3 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
Why is absorption important ?
Sergeeva-Olga [200]

Without efficient nutrient absorption, our body won’t function properly leaving us susceptible to deficiencies and disease.

Hope this helps

4 0
4 years ago
The particles resulting from weathering of rocks may lead to the formation of ____ rock. _______involves the transporting of sed
borishaifa [10]
Boom and hushing transition
3 0
3 years ago
Which of the following is not a characteristic of biofilms?
Ksenya-84 [330]

your answer would be c) iron deficiency

6 0
3 years ago
Other questions:
  • Exercising and eating healthy foods can prevent or delay diseases. This is an example of how ____________.
    10·1 answer
  • A warm rock is in direct contact with the cooler ground. Which of the following will
    6·2 answers
  • Chameleons are reptiles that have the ability to hide from predators and prey by blending in with their environment. They can ch
    8·2 answers
  • 5. After a signal is transmitted from the eyes through the optic nerve, which part of the
    10·2 answers
  • Assume that the affected individual has an x linked recessive disorder use X^A,X^a,
    14·1 answer
  • This is a form of striated, voluntary muscle tissue. It is linked to bone by bundles of collagen fibers known as tendons.
    7·1 answer
  • A student is given a small amount of unknown tan-colored liquid substance. This unknown liquid is placed into a glass of water a
    13·2 answers
  • Determine the nature of the expression of the lacZYA genes, represented by L, and label each genotype as constitutive, inducible
    10·1 answer
  • Which sample is a pure substance?
    10·2 answers
  • Most people: are exclusively right-brained. are exclusively left-brained. use both sides of the brain for all skills. have a rel
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!