1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hammer [34]
3 years ago
8

Which type of transport does transport proteins facilitate? A.Passive B.Active

Biology
1 answer:
dezoksy [38]3 years ago
3 0

Answer:

Active transport

:)

Explanation:

You might be interested in
If nondisjunction occurs and an individual survives, which disorder can occur?
Semenov [28]
The answer is Klinefelter syndrome.
Nondisjunction disorders are conditions resulting from an unbalanced distribution of chromosomes. In the case of Klinefelter syndrome, the sex chromosomes are affected. Rather than having an XX for female or an XY for male people with Klinefelters have either XXY or XYY.
3 0
4 years ago
Read 2 more answers
Devon, whose mother smoked during pregnancy, was born prematurely and had to have surgery for undescended testes when he was 9 m
jonny [76]
Maybe Ashema. If that, it won’t be too hectic I’m sure maybe issues with ashema while he’s young and may fade early it depends.
3 0
4 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Define Arteries.
Liula [17]

Answer:

{\boxed{\boxed{\tt { Arteries}}}} \

✏ Arteries are the vessels that carry blood away from the heart to various organs of the body.Since, the blood emerges from the heart under high pressure, the arteries have thick, elastic walls.

8 0
3 years ago
What are the three things that a plant needs to make its own food matter? What happens when a plant does not get these things? *
Kryger [21]

Answer:

Plants need carbon dioxide , water and sunlight to make their own food. if the plant does not get these things, the plant will stop converting carbon dioxide and air pollutant to organic material

Explanation:

 

8 0
4 years ago
Read 2 more answers
Other questions:
  • A nucleotide is a what
    9·2 answers
  • A group of organisms of the same species that live in an area is called a(n) _____
    13·1 answer
  • Which product of cellular respi tion is used by the human body for energy?
    14·2 answers
  • Why do plants produce there own food
    7·1 answer
  • Balance is not that important in an ecosystem.<br> True <br> False
    9·2 answers
  • Cells that are in<br>active protein<br>synthesis are filled<br>with which of the<br>following?​
    5·1 answer
  • Please help asap with 18
    15·2 answers
  • I am does this project of moon phases and its do soon I and need help finishing please help me.
    10·1 answer
  • Which cells can form ATP by breaking down glucose?
    5·2 answers
  • Diurnal are common orchids found in Australia the flowers of this species display a large number of varieties in color and makin
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!