1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
2 years ago
9

PLEASE HELP!!!!!! :)

Biology
1 answer:
Liono4ka [1.6K]2 years ago
6 0

Answer:

C

Explanation:

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Which statement describes transform boundaries?
WARRIOR [948]
Transform boundaries are places where plates slide sideways past each other. At transform boundaries lithosphere is neither created nor destroyed. Many transform boundaries are found on the sea floor, where they connect segments of diverging mid-ocean ridges. California's San Andreas fault is a transform boundary.
3 0
2 years ago
Wich occurs before the cell enters the g,2 stage of the cell cycle
Sidana [21]

g. dna replicates occurs before when the cell enters the g2 stage.

hope this helps! ❤ from peachimin

4 0
3 years ago
If you answer correctly i will award brainliest
earnstyle [38]
Second option/ the gametes produced by meiosis allow for closing organisms
5 0
3 years ago
Read 2 more answers
A. The trait for the disease is recessive, and each offspring had a 50% chance of receiving the recessive allele and developing
max2010maxim [7]
The answer to this question is the second option
6 0
3 years ago
Other questions:
  • Which would most likely trigger a climate change that could lead to a mass
    13·2 answers
  • What type of inheritance is observed in this pink and yellow flower?<br> ______
    9·2 answers
  • Study the equation for photosynthesis.
    10·2 answers
  • What type of glands are the gastric glands
    10·1 answer
  • Jordan is asked to draw an image of where he might find igneous rock. Jordan can figure out where this rock would be found by le
    14·1 answer
  • Which type of resource when gone is essentially gone forever
    11·1 answer
  • Some animals that try to adapt to climate changes eventually die due to starvation, as climate change alters the
    10·2 answers
  • What is the slowest moving weather front. Why<br> is it so slow?
    7·2 answers
  • What phenotypes are expected from a cross between a red flower and a white flower snapdragon?
    6·1 answer
  • Pagpapanatiling mabuting kaibigan at nagbibigay ng sariling opinyon<br><br>​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!