1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alecsey [184]
3 years ago
12

Cattle and buffalo share a similar fundamental niche, the entire set of conditions under which a population can survive and repr

oduce. A realized niche is the set of conditions actually used by a given population. Explain what the data in the Venn diagram suggest about the realized niches of the cattle and buffalo and their ability to coexist. Use evidence to support your explanation.
Biology
1 answer:
Vadim26 [7]3 years ago
4 0

Answer:

The data in the Venn diagram suggest about the realized niches of the cattle and buffalo and their ability to coexist with evidence is discussed below in detail.

Explanation:

2.

From the graph, it is observed that Cattle and Impala have the most overlay in their nutrition.

3.

When Sorensen's index worth is more like 1, there is a contestant among animals for their food manner needs.

From the Venn diagram, we recognize that Cattle and Impala have the most overlay in their nutrition. Also, Sorensen's index worth = 0.82 (closer to 1 concerning other partners.

4.

Sorensen's index for Buffalo and Cattle is 0.48 (cheapest among these 3 partners). So, they are less competitive. So, they can persist and generate easily.

You might be interested in
If bryophytes do not have vascular tissue how can some mosses reach 60 centimeters tall
nataly862011 [7]
They can grow tall, 60 cm plus
4 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Environmental scientists studies the impact of a newly discovered bacteria on oil. If the bacteria ingests oil they can possible
Blizzard [7]
The depended variable is the bacteria
7 0
3 years ago
Differentiate the osmosis in hypertonic and hypotonic solutions.
Nataly_w [17]

Answer:

A cell is in a hypertonic solution, the solution has a lower water concentration than the cell cytosol, and water moves out of the cell until both solutions are isotonic. Cells placed in a hypotonic solution will take in water across their membranes until both the external solution and the cytosol are isotonic.

7 0
3 years ago
22 POINTS AND BRAINLIEST
Serggg [28]

Answer:

The correct option is option "B"

Explanation:

pathogenic cells

3 0
3 years ago
Read 2 more answers
Other questions:
  • Leukoplakia is a condition characterized by a decrease in white blood cells
    11·1 answer
  • Explain why all bacteria are microscopic organisms
    8·1 answer
  • Chemical reactions that release energy
    10·1 answer
  • Which of the following statements about resource use is true ?
    14·1 answer
  • How can disruptions in the cell cycle lead to cancer?
    10·1 answer
  • Moving companies often use what three simple machines
    7·1 answer
  • 1. Explain how you classified the defenses as specific or nonspecific. What criteria did you use?
    11·1 answer
  • This is cooking class and I need your help please ​
    12·2 answers
  • Which planet is most like Earth in size and density?<br><br> A: Mercury<br> B: Venus<br> C: Neptune
    14·1 answer
  • Complete the sentence using one of the following words:ribosomes,lysosome, or vacuoles
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!