1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
3 years ago
13

MASTERY CONNECT MITOSIS

Biology
1 answer:
VashaNatasha [74]3 years ago
7 0

2nd Option is the correct one

You might be interested in
Compared to mammals in colder climates, mammals that live in very hot, dry ecosystems tend to
777dan777 [17]

Answer:

X. Mechanisms and habits that include limit water loss.

Explanation:

Many mammals that live in dry ecosystems tend to have above adaptations because there is a shortage of water in these areas. And of course water is the most essential thing for survival.

3 0
4 years ago
Defend the statement found in controversy that foods, not supplements are the best and safest form of phytochemicals.
Anika [276]

Answer:

The easiest argument is the next one:

Suppose phytochemicals are like money. If I put you in a phone cabin with a lot of money and give you 30 sec to be there collecting as much money as you can, at the end you will collect not all the money and a lot of money will be lost. The same happens whit phytochemicals in supplements there are so many that your body can't use them all.

And other thing is that phytochemicals in supplements comes so concentrated that your body will be overstimulated to take this phytochemicals and that changes your normal digestion, in the time it may looks good...but if you don't take supplements anymore, your body will feel the lost and the physical results would be awull.

8 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
What forms of energy are there?
Wittaler [7]

mechanical, kinetic, potential, gravitational, thermal, chemical, electrical, light, radiant, sound, and nuclear.

7 0
3 years ago
What was the connection between the political situations in Iran and Nicaragua during the mid-1980s?
Ilia_Sergeevich [38]
The connection between the political situations in Iran and Nicaragua during the mid-1980s was both countries fought the USSR with weapons supplied by the United States. The correct answer is D. 
6 0
3 years ago
Other questions:
  • The appendicular skeleton includes the bones of the upper and lower extremities and their supporting elements called
    8·1 answer
  • A nurse is assessing a client with crohn disease who is to have an upper gastrointestinal series. which condition necessitates t
    11·1 answer
  • Why is the action of phagocytes considered a nonspecific response?
    8·2 answers
  • An individual cell is able to make copies of its genetic information but it's unable to produce encoded proteins. this indicates
    11·1 answer
  • During photosynthesis, ___________ is reduced to ___________
    8·1 answer
  • Please help me on this question
    11·1 answer
  • Your coworker is known to have diabetes and begins to act tired. he becomes confused and loses the ability to sit up and swallow
    14·2 answers
  • How does E.coli affect a person?ω
    8·1 answer
  • Why do cells need to carry out
    11·2 answers
  • The two strands of dna are held together in a double helix by ______ bonds.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!