1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesya692 [45]
2 years ago
14

In the picture below, a ray of light hits a surface and changes direction. What is this action called?

Biology
1 answer:
satela [25.4K]2 years ago
6 0
This action is called reflection.
You might be interested in
When analyzing the results of a scientific experiment, Kevin should base his conclusion on
kirza4 [7]

Answer:

Predictive patterns seen during the scientific experiment.

Explanation:

A conclusion results from an observed pattern from an experimented results.

This predictive pattern is taken for further investigation on different conditions before a law is proposed.

7 0
2 years ago
In a eukaryotic cell, DNA is found in_______?
IrinaVladis [17]
In a eukaryotic cell, DNA is found in found<span> in the nucleus</span>
7 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which stage of the cell cycle results in two identical cells?
ludmilkaskok [199]

Which stage of the cell cycle results in two identical cells?

Answer:

Mitosis because mitosis itself consists of five active steps.

Hope I helped

--Jay

3 0
3 years ago
Read 2 more answers
Q.What is meant by biodiversity ? List two advantages of conserving forests and wildlife.​
Vesna [10]

Answer

it refers on the variety of life on earth at all its levels from genes to ecosystems and can encompass evolutionary ,ecological and cultural processes that sustain life

<h2><u>advantages of conserving forests and wildlife</u></h2>

1.It protects the endangered species.

2.It preserves different kind of species

Explanation:

3 0
3 years ago
Other questions:
  • Please help me in this question.
    8·1 answer
  • Round pea shape is dominant, and is represented with a capital R.
    14·2 answers
  • Using the help of the semi concevative replication of DNA, what is the role of a single strand of DNA
    15·1 answer
  • What molecule in the nucleus controls the copying of DNA ?
    14·2 answers
  • Do u know who drew this and what they used (pastel or chalk)
    13·2 answers
  • I have some biology questions. Best and fastest answer gets Brainliest!
    10·1 answer
  • Here is a drawing of a skeleton. Copy the drawing onto a separate piece of paper. Use colored pencils to fill in the skeleton. M
    8·2 answers
  • I don't understand. Can somebody help?​
    13·2 answers
  • You turn on a light so you can get a glass of water. BEFORE you turn on the light, your bipolar cells are __________________.
    9·1 answer
  • Because of temperature increases caused by global warming, identify the pattern of shift many North American animal and insect s
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!