C,the answer is C because enzymes are catalysts,they help speed up reactions.
The measure of side b as 64 ft is incorrect. The accurate measure would be 8 ft.
According to the Pythagorean theorem, the square of the hypotenuse of a right-angle triangle is the sum of squares of the opposite and the adjacent sides. Mathematically:

In this case, the hypotenuse = 10 ft, the opposite = 6 ft and the adjacent = b
Hence,
b^2 = 10^2 - 6^2
= 100 - 36
= 64
b = √64
= 8 ft
Thus, the side b is 8 ft and not 64 ft.
More on the Pythagorean theorem can be found here: brainly.com/question/16426393
Answer:
the relationship between genes, proteins, and traits a gene codes for a particular protein that is involved in the expression of a trait
Explanation:
characteristics determined by single genes are called Mendelian traits
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: