1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ber [7]
3 years ago
10

What ability have many cave fishes lost

Biology
1 answer:
denpristay [2]3 years ago
4 0

Answer:

most likely sight

Explanation: it is very dark in caves anyways, and their pupils would need to adjust to light, and of they have been living in a cave for a while, they would have adapted larger pupils to take in any possible light.

You might be interested in
An enzyme known as amylase is found in the saliva of humans. This enzyme helps to begin the process of digesting starch molecule
Anettt [7]

C,the answer is C because enzymes are catalysts,they help speed up reactions.


5 0
3 years ago
A student named Janine says that the measure of side b is 64 ft. Please state whether this is correct or incorrect. If this is i
kolezko [41]

The measure of side b as 64 ft is incorrect. The accurate measure would be 8 ft.

According to the Pythagorean theorem, the square of the hypotenuse of a right-angle triangle is the sum of squares of the opposite and the adjacent sides. Mathematically:

hypotenuse^2 = opposite^2 + adjacent^2

In this case, the hypotenuse = 10 ft, the opposite = 6 ft and the adjacent = b

Hence,

b^2 = 10^2 - 6^2

       = 100 - 36

          = 64

b = √64

     = 8 ft

Thus, the side b is 8 ft and not 64 ft.

More on the Pythagorean theorem can be found here: brainly.com/question/16426393

7 0
3 years ago
How are proteins related to traits?
mash [69]

Answer:

the relationship between genes, proteins, and traits a gene codes for a particular protein that is involved in the expression of a trait

Explanation:

characteristics determined by single genes are called Mendelian traits

3 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
all cells (prokaryotic and eukaryotic) have few common features. which cell feature is found in both prokaryotic and eukaryotic
Katyanochek1 [597]
The answer would be c. nucleus
4 0
3 years ago
Other questions:
  • A gene pool consists of all the genes within a
    11·2 answers
  • Your team must design an area in your school where students can relax between classes. You need to choose a material for a walkw
    7·2 answers
  • Which of the following includes only biotic factors?
    11·1 answer
  • A man and a woman have a child together. The mother's blood type is type and the child's blood type is type A What could the fat
    9·1 answer
  • A scientist studying the Milky Way galaxy notices a bright light in the sky. What information would she need to prove that the o
    14·1 answer
  • In the cell membrane, the molecules which move large molecules into and
    6·1 answer
  • You go on an expedition into the Amazon Rainforest to look for new species before they are destroyed by logging. You find one or
    13·2 answers
  • What are unicellular organisms<br>with<br>examples<br>what is the function of plasma membrane​
    8·1 answer
  • What type of mutation is depicted in this sequence
    5·1 answer
  • If each of these food chains start with 10,000 grams of phytoplankton, how much reaches the highest trophic level in each food c
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!