1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
3241004551 [841]
2 years ago
8

Instructions: 1 Using the DNA sequence, make a complementary RNA strand from both the human and the cow. Write the RNA directly

below the DNA strand (remember to substitute Us for Ts in RNA) 2. Use the codon table posted below (or the circular one on the first page) to determine which amino acids are assembled to make the insulin protein in both the cow and the human. Human DNA DNA CCA TAG CAC GTT ACA ACG TGA AGG AAA RNA GGU GLY Amino acid Cow DNA DNA CCA TAG CAT GTT ACA ACG CGA AGG GAC RNA Amino acid​

Biology
1 answer:
Ksenya-84 [330]2 years ago
4 0

Answer:

Please find the complete table attached as an image

Explanation:

This task is describing the processes of transcription and translation, which are the two processes involved in gene expression. The DNA of a human and cow is given in the table of the attached image and we're asked to transcribe into a complementary RNA, and subsequently translate into an amino acid using the CODON table (genetic code).

- Transcription is the process whereby DNA is used as a template for the synthesis of RNA based on complementary base pairing i.e. A-U, G-C, T-A etc.

- Translation is the process whereby RNA transcript is used to synthesize an amino acid sequence. The mRNA is read in a group of three nucleotides called CODON, where each of this codon specifies an amino acid.

The table has been completed and attached below. Note that in the amino acids row;

GLY means Glycine

ILE means Isoleucine

VAL means Valine

GLN means Glutamine

CYS means Cysteine

THR means Threonine

SER means Serine

PHE means Phenylalanine

ALA means Alanine

LEU means Leucine

You might be interested in
TRUE OR FALSE. Hyphae group together into a mass called chitin.
Oksanka [162]
<span>The hyphal walls are made of a substance called ... They have cells walls made of chitin, reproductive cells i think its true</span>
7 0
3 years ago
Read 2 more answers
How does latitude affect the amount of solar radiation the Earth receives?
Svetach [21]
The answer to your question is A. Higher latitudes receive less radiation due to the curvature of the Earth.

Hope this Helps! :) please mark me Brainiest! :)
5 0
3 years ago
The world is continuing to expand economically, and consumers are demanding for products. Which of the following is the most dir
dolphi86 [110]

Answer: Tree Good

Explanation: No more Tre ekuiL no mor

are

5 0
3 years ago
What evidence has allowed scientists to conclude that the common ancestor of modern chimps and humans lived around 7 million yea
tatyana61 [14]

Biological molecules such as proteins and DNA reveal differences between humans and chimps that would have taken around 7 million years to accumulate.

<h3>What is DNA?</h3>

All known animals and viruses have genetic information in the form of deoxyribonucleic acid, a polymer consisting of two polynucleotide chains that coil around one another to form a double helix. Ribonucleic acid is a type of nucleic acid, as is DNA.

The two DNA strands are known as polynucleotides because they are constructed from simpler monomeric units called nucleotides.

The four nucleobases that contain nitrogen—cytosine (C), guanine (G), adenine (A), or thymine (T)—along with deoxyribose and a phosphate group—make up each nucleotide. The sugar of one nucleotide and the phosphate of the following make covalent bonds, creating what is known as the phospho-diester linkage, which results in an alternating sugar-phosphate backbone.

To learn more about DNA visit:

brainly.com/question/264225

#SPJ4

8 0
1 year ago
A wilted house plant is watered explain how structure 1 and 3 is going to work together to cause a change in the plant
Ksivusya [100]

Answer:

baby I am Rehan I am Rehan I am Rehan I am Rehan

3 0
3 years ago
Other questions:
  • The dictionary defines equilibrium as a situation in which forces
    8·1 answer
  • What chemical must plants contain to carry out photosynthesis?
    14·2 answers
  • Plants use carbon dioxide to build organic molecules during the process of
    7·2 answers
  • A sonic boom is produced by a jet. What can you determine about the jet's motion?
    10·2 answers
  • What is usually (but not always) related to the metabolic processes of living organisms in its organic form?
    13·1 answer
  • The source of energy for most autotrophs is
    15·1 answer
  • Explain the process of energy moving through the atmosphere.
    5·1 answer
  • How did the stop codon mutation in Lucy’s ADA gene stop her ADA protein from working?
    15·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Conduction is the transfer of heat through
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!