1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Over [174]
3 years ago
7

What is a cell wall and what are its functions ​

Biology
1 answer:
defon3 years ago
8 0

Answer:

a rigid layer of polysaccharides lying outside the plasma membrane of the cells of plants, fungi, and bacteria. In the algae and higher plants it consists mainly of cellulose.

Explanation:

i hope this helps!

You might be interested in
if the ratio of the ages of kisii and esinam is 3:5 and that of Esinam and Larry is 3:5 and the sum of the ages of all three is
larisa [96]

Answer:

The age difference between the oldest and the youngest is 48.

Explanation:

Given the following data;

The ratio of the ages of Kisii (K) and Esinam (E) is 3:5.

The ratio of the ages of Esinam (E) and Larry (L) is 3:5.

The sum of the ages of all three is 147.

Since the age of Esinam is common in both ratios, we find the lowest common multiple (LCM);

LCM of 3,5 = 15.

Hence, the ratio of the three ages is now;

K:E:L = 9:15:25

Let their ages be denoted by x;

K:E:L = 9x:15x:25x

The sum of all three ages is;

9x + 15x + 25x = 147

49x = 147

x = 147/49

x = 3.

To find the age difference between the oldest and the youngest;

The oldest is Esinam = 25x

The youngest is Kisii = 9x

Therefore, 25x - 9x = 16x

Substituting the value of x, we have;

x = 3; 16x = 16(3) = 48.

The age difference between the oldest and the youngest is 48.

6 0
3 years ago
What is meant when water is called a polar molecule.
Serga [27]
Because electrons are “pulled” towards the oxygen.
5 0
2 years ago
Which part of a robot converts stored energy into movement?
MAXImum [283]

Answer:your mom

Explanation:

7 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
N sexually reproducing organisms, genes are transferred via _______________?
Igoryamba

egg (female) and sperm ( male)

4 0
3 years ago
Other questions:
  • What is the likely advantage of growing a genetically modified variety of corn that possesses its own pesticide?
    5·2 answers
  • in an experiment to determine the effect of exercise on pulse rate student checks his pulse rate and after exercising for severa
    7·1 answer
  • A certain species of salamander was split into two populations by a wide, dry valley, and the populations began to diverge from
    12·1 answer
  • 1. What is surface tension?
    15·1 answer
  • One of the most important bioethical issues facing us today is the issue of ____________ , or a loss thereof.
    5·1 answer
  • A medical researcher experimented with the effects of calcium intake on the healing time of broken bones. People who had
    8·1 answer
  • The Andes Mountains are found along the western coast of South America. Which kind of plate boundary is responsible for this mou
    13·2 answers
  • Which gas in the atmosphere might decrease?
    12·1 answer
  • (a) The consequences of a growing human population have been a concern since the times of Thomas Malthus when he proposed that h
    12·1 answer
  • Choose all that apply. Which of the following is true in a comparison of your skin cells to your kidney cells?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!