1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
3 years ago
15

Which two factors are most likely to cause a plant's guard cells to open its stomata?

Biology
2 answers:
lys-0071 [83]3 years ago
8 0

Answer:B

Explanation:

SOVA2 [1]3 years ago
3 0

the correct answers are B and D

the increased sunlight will determine the guard cells to start photosynthesis, this will result in an incresed glucose concentration inside the guard cells .The increased glucose concentration will cause osmotic pressure to build up, so the guard cell will absorb water from neighbouring cells, this will cause increased turgor pressure that will deform the cells in order for the stomata to open

You might be interested in
Find the hypotenuse of a right triangle whose legs both have a length of 5.
natali 33 [55]

Answer:

Hypotenuse = 7.07 units.

Explanation:

The sides of the right angle triangle are the opposite and adjacent side; which are both equal in this case.

Given the following data;

Opposite = 5 units

Adjacent = 5 units

To find the hypotenuse, we would use the Pythagorean theorem given by the formula;

Hypotenuse² = opposite² + adjacent²

Hypotenuse² = 5² + 5²

Hypotenuse² = 25 + 25

Hypotenuse² = 50

Hypotenuse = √50

Taking the square root of both sides, we have;

Hypotenuse = 7.07 units.

7 0
3 years ago
If Phoenix, Arizona, experiences a cool, wet day in June (when the weather is usually hot and dry), does that mean the region’s
Andru [333]
No, Just because it snowed one day in  the middle of summer doesn't mean climate is changing, its just an oultier
8 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
What was the estimated carrying capacity of the Kaibab plateau in 1905?
Novosadov [1.4K]

The average carrying capacity of the range was estimated to be about 30,000 deer.

3 0
3 years ago
Read 2 more answers
I need help with dis the one dat says a diagram
Grace [21]
Hello, is there anyone here a pharmacy technician?
5 0
2 years ago
Read 2 more answers
Other questions:
  • Name any four materials that we should avoid using to save our environment and why?
    5·2 answers
  • Which of the following statements regarding the function of mitosis is false?
    12·1 answer
  • A 13-year-old girl is being evaluated for possible crohn's disease. the nurse expects to prepare her for which diagnostic study?
    11·1 answer
  • What additional information would assist you in determining whether polar bears and grizzlies are different species, based on th
    8·1 answer
  • Please help!!! Will give brainliest!!!
    11·2 answers
  • If the slope of a straight line is calculated using the equation, "m=(y2-y1)/(x2-x1)," what is the slope of the graph below?
    14·1 answer
  • The ______ innervates a variety of organs, including the adrenal medulla, that results in the release of catecholamines from the
    11·1 answer
  • What is a phytoplankton? If yall searching it up it non-correct
    5·1 answer
  • PLEASE I NEED HELP ASAP GIVING 75 POINTS IF YOU COMPLETE ALL AND BRAINLIEST!!!
    11·1 answer
  • The term meaning bleeding from the lungs is
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!