1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marta_Voda [28]
3 years ago
9

1. In a soil ecosystem, matter _________________ and energy ___________________.

Biology
1 answer:
Aliun [14]3 years ago
6 0

Answer:

Recycled, not recycled

Explanation:

In a soil ecosystem, matter is recycled and energy isn't recycled.

Matter is recycled through biogeochemical cycles. Matter has to be recycled because it can neither be created, nor destroyed, and as such, recycling is the only option left.

Energy isn't recycled because most of the energy gotten is used by organisms, as gotten from the plants already, and thus, when it gets to the food chain there isn't much left to be recycled.

You might be interested in
Synapsis is when the homologous chromosomes pair up (come together).<br> True<br> False
nikklg [1K]
Definitely true.......
7 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
You are charged with securing a site to build a wind farm as you survey different potential sites you look for the one that
bonufazy [111]
The reasonable answer to me would be If you are building a wind farm, you'd want a place where the wind constantly blows so you could harbor the wind and turn it into energy.
4 0
3 years ago
Read 2 more answers
What is the difference between the mosses and ferns gametophyte stages
Ivan
The difference is that Moses is a human but had a great connection with god and fern was a god. Hop this helps:-))
5 0
4 years ago
How do plant cells make sugars from sunlight and then convert the sugars to cell energy/atp
Natalija [7]
Here is your answer

4 0
3 years ago
Read 2 more answers
Other questions:
  • Most of cellular respiration take place in what
    13·2 answers
  • The oxidation of sucrose (sugar) into CO2 + H2O can occur quickly or slowly. Which of these modifications to the reaction is lik
    10·2 answers
  • During the embryonic development of which types of invertebrates does the true coelom develops from the two pouches off the prim
    10·1 answer
  • Help asap <br> Name and describe two types of mechanical weathering.
    5·1 answer
  • According to the Acceptable Macronutrient Distribution Ranges (AMDR), what percentage of total calories should come from carbohy
    5·1 answer
  • Structural genes are: Group of answer choices a) genes of which the first products are mRNAs b) genes encoding polypeptides that
    6·1 answer
  • What is the relation between chromatin and chromosomes
    12·1 answer
  • Please help will mark brainly
    7·2 answers
  • PLEASE HELP I WILL GIVE BRAINLY!!!!!!!
    9·2 answers
  • Gracias al transporte activo
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!