1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gogolik [260]
3 years ago
13

Carbon atoms have four valence electrons are they likely to react with other atoms and why or why not?

Biology
1 answer:
mrs_skeptik [129]3 years ago
7 0
I would say the answer is C
You might be interested in
What purpose does the alcohol serve in this lab? Why is this an important step?
Juli2301 [7.4K]

Explanation:

The role of alcohol in DNA extraction is to precipitate DNA into a visible form. Also, it's used in DNA washing and storing

8 0
3 years ago
Explain what happens if the appendix became infected.
Gnoma [55]

Answer:

Explanation:

The bacteria multiply rapidly, causing the appendix to become inflamed, swollen and filled with pus.

8 0
2 years ago
It takes approximately _____ action· potentials from olfactory receptors for us to perceive· an odor· .
taurus [48]
Action potentials (i.e. nerve impulses) occur in several types of animal cells<span>, called </span>excitable cells<span>, which include </span>neurons<span>, </span>muscle cells<span>, </span>endocrine<span> cells, and in some </span>plant cells<span>. </span><span>It takes around 40 action potentials for a smell sensation to be reported.</span>
3 0
4 years ago
The embryo has all the basic organs and body parts (except male and female organs) at approximately how many weeks after concept
denpristay [2]

After the completion of first trimester that is 8 weeks of conception, the baby is almost 1 inch grown. At this stage, the baby is referred as fetus. At this stage, all the organs as well as limbs becomes visible except for the sex organs.

The heart of baby beats rhythmically. Eyes and the eyelids are completely visible. Both the forelimbs and the hind limbs are formed, and fingers buds are also visible.

At this stage, the fetus looks like a human. The umbilical cord is also clearly visible at this stage.

Hence, the correct answer is 8th week.

4 0
3 years ago
Which of these orbits Earth?<br> A. Moon<br> B. Sun<br> C. Jupiter
Mamont248 [21]
A Moon mark as brainliest if correct
5 0
3 years ago
Read 2 more answers
Other questions:
  • In a population at hardy-weinberg equilibrium with two alleles, a and a, 264 of the 1200 individuals display the recessive trait
    7·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • The walls of ______ contain ______ that provides mechanical support to a plant.
    9·2 answers
  • PLEASE HELP ME!!!!!
    5·1 answer
  • Which of the following stages in the breakdown of the piece of toast you had for breakfast generates the most ATP?
    11·1 answer
  • Water has a much higher specific heat than most other covalent compounds. What do you predict might happen if water had a low sp
    14·1 answer
  • A bond formed by the electrical attraction between two oppositely charged ions is a(n)_____.
    9·2 answers
  • Why use liposomes in drug delivery?
    7·1 answer
  • The stigma is the opening in a flower through which pollen moves to ferilize the eggs. Which characteristic would be most helpfu
    11·1 answer
  • What processes could cause a metamorphic rock to return to the surface of Earth to be worn down again?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!