Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The answer is option A)cyclins
Yesssssssssssssssssssssirrrrr
if the earth had not evolved it would be just like every other planet, no life forms, not polluted and pure. it would be clean and there would probably be a few organisms but not how we are now. Global warming would not be there and the plastic in the oceans would also not be there.
The cell membrane is made up of a phospholipids that are arranged into two layers which are called lipid bilayer.
