1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
13

Zinc, an essential trace element for most organisms, is present in the active site of the enzyme carboxypeptidase. The zinc most

likely functions as _____. Zinc, an essential trace element for most organisms, is present in the active site of the enzyme carboxypeptidase. The zinc most likely functions as _____. a noncompetitive inhibitor of the enzyme an allosteric activator of the enzyme a coenzyme derived from a vitamin a cofactor necessary for enzyme activity
Biology
1 answer:
azamat3 years ago
7 0

Answer:

The correct answer is a cofactor for enzyme activity.

Explanation:

Carboxypeptidase is a metallo-enzyme in which zinc is present at active site. It has been accounted for by Coleman and Vallee that the protein can be deactivated by the removal of zinc and that reactive again by the expansion of zinc, cobaltous, ferrous, nickel. which suggests that zinc is acting as the cofactor for this metalloenzyme. Zinc is a cofactor for up to 300 chemicals in the body. Proteins that utilization zinc as a cofactor is known as metalloenzymes.

Thus, the correct answer is a cofactor for enzyme activity.

You might be interested in
Lithified ash (or ash mixed with pyroclastic fragments) forms a volcaniclastic rock called a:________
sweet [91]

Lithified ash (or ash mixed with pyroclastic fragments) forms a volcaniclastic rock called a Tuff.

  • A form of rock called tuff is created when volcanic ash is blasted from a vent during an eruption.
  • The ash is transformed into a rock after ejection and deposition. Tuff is defined as rock with an ash content of more than 75%, whereas tuffaceous refers to rock with an ash content of 25% to 75%.
  • The thickness of tuff often decreases with distance from the volcano and is usually greatest close to the volcanic vent. The typical shape of a tuff deposit is that of a "lens," not a "layer."
  • Tuff may also be thickest on the vent's side that faces away from the wind or on the side facing the direction of the blast.

learn more about tuff here: brainly.com/question/27870503

#SPJ4

4 0
2 years ago
4. Which of the following statements best describes how the traits of an organism are determined
butalik [34]

Answer Choices:

DNA provides the energy needed for an organism to grow and function

DNA is copied into mRNA, which controls cellular functions

DNA codes for proteins, which allow an organism to grow and function

DNA unzips and each strand codes for a different amino acid

Answer:

DNA codes for proteins, which allow an organism to grow and function

Explanation:

DNA provides the energy needed for an organism to grow and function  - this is false. DNA does not provide energy. A molecule called ATP, mostly produced by cellular respiration, provides energy for the cells to grow and function.

DNA is copied into mRNA, which controls cellular functions  - this is false. While it is true that DNA is copied into mRNA, mRNA does not directly control cellular functions. Instead, mRNA is translated into proteins.

DNA codes for proteins, which allow an organism to grow and function  - <u>this is true, as indicated above, DNA is transcribed to mRNA which is translated into proteins. Proteins carry out essentially all the functions in the cell</u>

DNA unzips and each strand codes for a different amino acid - this is false, DNA is transcribed into mRNA. Each mRNA codon (three bases) codes for a different amino acid

6 0
3 years ago
What is the importance of understanding Mendel's laws of segregation and independent assortment?
andriy [413]
Well first off, Mendel’s law of segregation states that individuals possess two alleles and a parent passes only one allele to his/her offspring. Mendel’s law of independent assortment states the inheritance of one pair of factors (genes) is independent of the inheritance of the other pair. Now Mendel discovered this through his little experiment with the pea plants that showed certain traits through a particular pattern, subsequently becoming the foundation of modern genetics and heredity.
7 0
3 years ago
Read 2 more answers
John wants to conduct an experiment to determine why his bedroom is 1 point
sergiy2304 [10]

Answer:

hi

Explanation:

8 0
3 years ago
Pleaseeee help!!! This is due today!!
o-na [289]

Explanation:

Vxbdguwu. Eheihr3 udievveudb edhrbvrhdi r djidh e D I ve isus. E

8 0
3 years ago
Read 2 more answers
Other questions:
  • While mRNA strands are being created a sequence is sometimes miscopied. What is the best possible outcome, the worst possible ou
    9·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A 14-year-old boy has been diagnosed with infectious mononucleosis. Which of the following pathophysiologic phenomenon is most r
    14·1 answer
  • Which statement describes a shield volcano
    9·1 answer
  • Which statements are additions to cell theory, called modern cell theory? Check all that apply.
    9·2 answers
  • Which of these statements is correct about a scientific law?
    10·1 answer
  • 4 points
    12·1 answer
  • Which organelle is responsible for making lipid molecules that will be used by the cell?
    10·1 answer
  • How does increasing plant biomass (amount of plants) affect atmospheric CO
    15·1 answer
  • I want a sister I can’t live like this with my parents
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!