1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kruka [31]
3 years ago
6

What is duplicate genes????​

Biology
1 answer:
Contact [7]3 years ago
8 0

Answer:

Duplication is a type of mutation that involves the production of one or more copies of a gene or region of a chromosome. Gene and chromosome duplications occur in all organisms, though they are especially prominent among plants. Gene duplication is an important mechanism by which evolution occurs.

You might be interested in
Help plsssss Thomson's contribution to the atomic theory was the discovery that negatively-charged electrons were embedded withi
Shkiper50 [21]

Answer:

A. the atom is made up of the mostly empty space with tiny, dense, positively-charged nucleus.

Explanation:

8 0
3 years ago
Insects obtain oxygen through __________________________, which are small abdominal holes that lead into tracheal tubes called t
Elanso [62]
<span>Oxygen travels to insect tissues through tiny openings in the body walls called spiracles, and then through tiny blind-ended, air-filled tubes called tracheae. Therefore, insects obtain oxygen through the spracles, which are small abdominal holes that lead into traecheal tubes called tracheae that branch into smaller tubes called tracheoles. From there, oxygen diffuses into body cells.</span>
6 0
4 years ago
A personal trainer observes a client's knees moving inward while performing the overhead squat assessment. Which of the followin
guajiro [1.7K]

Answer:

Option C

Explanation:

Gastrocnemius and soleus muscles are jointly known as calf. Gastrocnemius is the larger muscle and connects to the knee joint while soleus is smaller muscle that connects to the portion of leg just below the knee. When gastrocnemius is stretched, the knee remains straight while when the soleus is stretched the knee bends. If a person feels difficulty in bending or stretching the knees, he/she must be facing the problem with the calf muscle. Hence, Option C is correct

7 0
3 years ago
(31) The rough endoplasmic reticulum (A) has ribosomes bound to it (B) is part of the membrane system found throughout the cell'
worty [1.4K]

Answer:

(D) all of the above

Explanation:

The rough endoplasmic reticulum is part of the endoplasmic reticulum, the other one is known as the smoother endoplasmic reticulum.

1. This rough endoplasmic reticulum is considered rough because it has ribosomes bound to it.

2. Also, it is part of the membrane system found throughout the cell's cytoplasm, even though its density is considered to be higher in some places, such as near the nucleus.

3. It is also is connected to the nuclear envelope or membrane

Some of its functions include

1. It produces antibody in certain leukocytes

2. It produces insulin in pancreatic cells

Hence, in this case, the correct answer is Option D "all of the above."

4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Other questions:
  • When testing for the types of macromolecules that make up different articles of food, there are four tests that are commonly uti
    14·1 answer
  • Which level of organization in the classification system is directly above the phylum level? Class Domain Kingdom Order
    15·2 answers
  • Why does it hurt when you get kicked in the balls?
    7·1 answer
  • Answer with a reason and complete sentences
    6·2 answers
  • After reviewing the results of your science fair project, you state that water has increased the growth of fungi. This is a(n)
    9·2 answers
  • A certain population of lizards has a very small gene pool, with little variation. How does this affect the chance that individu
    6·1 answer
  • What is this data saying?
    13·1 answer
  • What are the 6 classification of sewing equipment​
    15·1 answer
  • What differences exist between the Zone of Maturation and Zone of Elongation?
    6·1 answer
  • Before a g protein can activate adenylate cyclase, a) it releases a second messenger. b) it hydrolyzes gtp. c) is dissociates in
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!