1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
torisob [31]
3 years ago
8

Which is an example of a mineral being used in everyday life?

Biology
1 answer:
Airida [17]3 years ago
5 0
All of the above ❤️Hope this helps
You might be interested in
The electron transport chain is composed of adjacent electron carriers in the inner mitochondrial membrane. It generates energy
Sav [38]

Answer:Although protons resemble other positive ions such as Na+ and K+ in their movement across membranes, in some respects they are unique. Hydrogen atoms are by far the most abundant type of atom in living organisms; they are plentiful not only in all carbon-containing biological molecules, but also in the water molecules that surround them. The protons in water are highly mobile, flickering through the hydrogen-bonded network of water molecules by rapidly

3 0
3 years ago
What causes Swollen Shoot Disease?
monitta

Answer:

Swollen shoot is a viral disease transmitted to the plant by mealybugs that has devastated Ghanaian and Nigerian cocoa crops.

Explanation:

<em>Please</em><em> </em><em>mark</em><em> </em><em>me</em><em> </em><em>as</em><em> </em><em>brainliest</em><em> </em><em>answer</em><em> </em>

8 0
3 years ago
PLEASE HELP!!!!
Ivanshal [37]

Answer:

To cleave DNA strands at specific nucleotide sequences

Explanation:

Google

7 0
3 years ago
The illustrations are models of cells and cell organelles.
Aloiza [94]

Answer:

B

Explanation:

Because of the different shapes and components that a prokaryotic cell has such as flagellum that isn't show on the other ones

5 0
3 years ago
What organism make energy
nasty-shy [4]

Answer:

plants

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Biology.
    14·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • List The Difference Between Monocots And Dicots.
    15·2 answers
  • Describe Nebular Theory, including what it explains and the steps in the process
    10·1 answer
  • What macromolecule is composed of CHNOP? Select all that apply
    10·1 answer
  • What do you think plants need to stay healthy
    14·2 answers
  • What are traces or remains of organisms that lived in the past?
    8·2 answers
  • What do homologous structures, vestigial and fossils provide evidence of
    8·2 answers
  • A gene that is hidden is called a
    14·2 answers
  • What is mentruation? give example​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!