All categories

3 years ago

How does proteinsynthesis happen in the ribosome

1 answer:

8 0

First of all, transcription needs to happen inside the nucleus. An enzyme called RNA polymerase uses a strand of DNA as template for mRNA (messenger RNA) synthesis. The mRNA contains the codons. The next step of protein syntheis is called translation and occurs in the ribosome. Codons are groups of three letters that code for an amino acid. When the mRNA comes to the ribosome each codon pairs with an anticodon. Groups of three base pairs that are complementary to codons and are present in the tRNA(transfer RNA).

Each tRNA molecule has an amino acid attached to it and a specific anticodon. Depending on the order of codons proteins are build by binding amino acids.

You might be interested in

It's 3 questions this time.

Vinvika [58]

Answer: 3. in the icecaps. 2. temperature. 1. the second one

Explanation:

6 0

3 years ago

Fill in the blank Competition drives natural selection as individual members of a species compete with each other for limited na

maks197457 [2]

Answer:

1. Intraspecific

2. speciation

3. fossil record

4. The fossil record provides empirical evidence for evolution because it shows that species now aren't the same as species that existed in the past and that small changes happen over time to create new species.

5. A geographic variation in the fossil record occurs when two similar organisms occupy the same time span in two different places. These organisms hold the same purpose within the overall ecology.

6. A more detailed fossil record is preferable for supporting evolution because it allows for the instances of gradual change to be recorded and placed into broader speciation events.

7. Fossils provide a great many intermediaries that connect past species with their living descendants.

8. Intraspecific competition is competition that occurs within species. This is the competition that drives natural selection.

Explanation:

penn foster

8 0

4 years ago

Which would be classified as a pollutant?

ASHA 777 [7]

A pollutant is a substance or energy introduced into the environment that has undesired effects, or adversely affects the usefulness of a resource.

5 0

3 years ago

Read 2 more answers

Need help question in picture

bogdanovich [222]

C would be your answer

4 0

3 years ago

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

netineya [11]

Answer:

The complementary base pair is ATG TTT GTG ATA TGG CGC ATT TAC TAA

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC AAA CAC TAT ACC GCG TAA ATG ATT

ATG TTT GTG ATA TGG CGC ATT TAC TAA

5 0

3 years ago

How does proteinsynthesis happen in the ribosome​

How does proteinsynthesis happen in the ribosome