1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DIA [1.3K]
3 years ago
6

Please help!! i need an answer for plato and the answer choices are only A B C and D

Biology
1 answer:
yawa3891 [41]3 years ago
8 0

Answer:

B

Explanation:

B is when they condensate( air to the cloud)

Hope this helps plz hit the crown :D

You might be interested in
Why is Gregor Mendel important?
Wittaler [7]
Gregor Mendel, an Austrian monk, is credited with discovering the basics of heredity. He is known as the father of modern genetics due to his experiments and discoveries.
4 0
3 years ago
What are the two parts of cell division?
Brrunno [24]

Answer:

mitosis and meiosis.

Explanation:

5 0
3 years ago
Read 2 more answers
_________ is an organ of the alimentary canal?
vovangra [49]

Answer:

Small intestine

Explanation:

The given question has not provided the options neither they are found anywhere therefore it can be assumed that the examiner is asking the most important organ of the alimentary canal.

The alimentary canal is the hollow tube-like structure formed inside the human which are associated with the digestion of the food material. The main organs of the alimentary canals are the oesophagus, stomach and the intestine.

The intestine is the main organ of the canal as it is associated with the digestion of the complex biomolecules and the absorption of these nutrients.

Thus, the small intestine is the correct answer.

5 0
3 years ago
Some of the most common issues around which emergency department lawsuits are centered are:
Vikki [24]

Emergency department lawsuits are becoming more rampant nowadays, some of the most common reasons for these lawsuits are listed below:

 

1. Improper and inadequate administration of medication

2. Failure to admit a patient

3. Sparse medical documentation

4. Contradictory medical documentation

5. Failure to render care

6. Inappropriate discharge or transfer

4 0
3 years ago
What is the Pros and cons of genetic engineering?
dexar [7]

Answer:

Pros and Cons of Genetic Engineering

Pros and Cons of Genetic EngineeringTackling and Defeating Diseases.

Pros and Cons of Genetic EngineeringTackling and Defeating Diseases.Getting Rid of All Illnesses in Young and Unborn Children.

Pros and Cons of Genetic EngineeringTackling and Defeating Diseases.Getting Rid of All Illnesses in Young and Unborn Children.Potential to Live Longer.

Pros and Cons of Genetic EngineeringTackling and Defeating Diseases.Getting Rid of All Illnesses in Young and Unborn Children.Potential to Live Longer.Produce New Foods.

Pros and Cons of Genetic EngineeringTackling and Defeating Diseases.Getting Rid of All Illnesses in Young and Unborn Children.Potential to Live Longer.Produce New Foods.Organisms Can be 'Tailor-Made'

Pros and Cons of Genetic EngineeringTackling and Defeating Diseases.Getting Rid of All Illnesses in Young and Unborn Children.Potential to Live Longer.Produce New Foods.Organisms Can be 'Tailor-Made'Faster Growth in Animals and Plants.

Pros and Cons of Genetic EngineeringTackling and Defeating Diseases.Getting Rid of All Illnesses in Young and Unborn Children.Potential to Live Longer.Produce New Foods.Organisms Can be 'Tailor-Made'Faster Growth in Animals and Plants.Pest and Disease Resistance

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which parts of the body assessed by the nurse would confirm a diagnosis of frostbite? select all that apply?
    8·1 answer
  • Help I have the decoder just text me please
    12·1 answer
  • Can someone plz answer my question
    14·1 answer
  • Each of the four pedigrees that follow represents a human family within which a genetic disease is segregating. Affected individ
    5·1 answer
  • How does having a diverse gene pool help a species survive
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Gravity's force depends on _____ the two objects are and how much _____ each object has.​
    9·1 answer
  • Ducks have waterproof feathers that help maintain their body temperature. Which body system are these characteristics a part of?
    5·2 answers
  • This sequence best represents
    10·1 answer
  • Do you think people should be able to patent DNA? Should people have the right to trademark their own DNA? Explain why or why no
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!