1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marusya05 [52]
2 years ago
7

Someone please help me i need this as quick as possible

Biology
2 answers:
Pachacha [2.7K]2 years ago
5 0

Answer:

1: A

2: E

Explanation:

katrin [286]2 years ago
4 0

Answer:

A, F

Explanation:

You might be interested in
HELP PLEASE HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
zhuklara [117]

B. Gravitational forces

5 0
3 years ago
Read 2 more answers
Explain how water is used to create electricity.
Kamila [148]

Answer:

Explanation:Flowing water creates energy that can be captured and turned into electricity.The most common type of hydroelectric power plant uses a dam on a river to store water in a reservoir. Water released from the reservoir flows through a turbine, spinning it, which in turn activates a generator to produce electricity.

7 0
2 years ago
Read 2 more answers
Because there are three different possible reading frames in a messenger RNA (mRNA) molecule, most mRNAs can be translated in a
Dmitry [639]

Answer:

False

Explanation:

In the genetic code, each triplet of nucleotides (i.e., each codon) determines one specific amino acid or one-stop codon. The genetic code is not overlapping, which means that the same letter in the genetic code (nucleotide) cannot be used for two different codons. There are 64 possible combinations of triplets of nucleotides, 61 of them determine amino acids, while three triplets determine stop codons (UAG, UAA, and UGA) that indicate the termination of translation. Moreover, the genetic code is also degenerate, which means that one amino acid can be coded by more than one codon.

7 0
2 years ago
What makes one protein different from another one?
NARA [144]
Proteins differ from one another primarily in their sequence of amino acids
4 0
3 years ago
Read 2 more answers
What is the phenomenon that takes place at the level of the green leaves of the carrot
gulaghasi [49]

Explanation:

tttyyygftj that's all I have

3 0
2 years ago
Other questions:
  • Quartz is a rock-forming mineral.<br><br> True<br><br> False
    7·1 answer
  • In what ways is the evolution of a massive
    6·1 answer
  • A forest fire in Florida clears thousands of acres of trees. What are the consequences for the animal populations in the surroun
    9·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • (WILL GIVE BRAINLIEST!) Help! 1 &amp; 2.
    7·1 answer
  • In the absence of repair, what would the replication of a double helix containing a mismatch yield? Group of answer choices a.on
    9·1 answer
  • In which structure do sperm cells develop?
    15·2 answers
  • Outline the levels of organization starting with the smallest, organisms.
    12·1 answer
  • What is the complementary strand for the DNA sequence shown here?<br> A-T-G-G-C-A
    8·1 answer
  • La cantidad de energía que llegaría al cuarto nivel trófico en un ecosistema
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!