1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nordsb [41]
3 years ago
8

An egg is dropped into a highly concentrated Kool-Aid solution made of 99% Kool-Aid powder and 1% water.

Biology
1 answer:
bekas [8.4K]3 years ago
4 0
Since an eggshell is semi permeable some of the paste would most likely seep through
You might be interested in
A species has Homolgous chromosomes. What does this say about the species
DochEvi [55]

Answer:  heres your answer

Explanation:  having homologous chromosomes indicates  that the organism is a DIPLOID  SPECIES.

6 0
3 years ago
How are these two laws (law Dominance and Segregation) related
Kazeer [188]
This law explains that the pair of alleles segregate from each other during meiosis cell division (gamete formation) so that only one allele will be present in each gamete. ... Every organism inherits two alleles for each trait. The two alleles of a pair are different, i.e., one is dominant and one is recessive.
5 0
3 years ago
In a population of plants, the allele for long stems is completely dominant over the allele for short stems. If 35% of the popul
KatRina [158]
Assumptions:
1. Equilibrium has been reached for the allele proportions
2. Absence of <span>evolutionary influences such as </span>mate choice<span>, </span>mutation<span>, </span>selection<span>, </span>genetic drift<span>, </span>gene flow<span> and </span>meiotic drive<span>.
</span>
Defining L=long stem, l=short stem, and L is dominant over l.
f(x) = frequency of allele x  (expressed as a fraction of population)
Then the Hardy-Weinberg equilibrium law applies:
p^2+2pq+q^2=1
where 
f(LL)=p^2
f(Ll)=2pq
f(ll)=q^2

Given f(ll)=0.35=q^2, we have
q=sqrt(0.35)=0.591608
p=1-q=0.408392
=>
f(Ll)
=2pq
=2*0.408392*0.591608=0.483216
= proportion of heterozygous population

Answer: percentage of heterozygous population is 48.32%
7 0
3 years ago
In science class, Maria observes a white-colored cut flower. She sees that the petals turn red when the flower is sitting in a v
GuDViN [60]

To confirm the above hypothesis, Maria should perform an experiment to prove that xylem is responsible for the transport of coloured water through the plant. This is called the ascent of sap.

A suitable plant having a tender, semitransparent stem should be selected. The root system of the plant should be cut off and the twig has to be placed half-immersed in a coloured solution of water for about one hour. Later, when the plant is observed, parallely running streaks of coloured water can be seen through the semitransparent stem and other parts of the plant indicating that the xylem is involved in the upward movement of water.

5 0
3 years ago
Read 2 more answers
PLEASE ANSWER ASAP!! AM BEING TIMED !!
Ganezh [65]

Answer:

solid wastes on land

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Btx depolarizes the membrane and prevents repolarization. what effect would this have on electrical signaling by the nervous sys
    10·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The chemical process through which glucose and other organic molecules are broken down to release energy is known as
    6·1 answer
  • Which gas in Earth’s atmosphere helps living things make proteins?
    8·2 answers
  • If the first 3 nucleotide bases (1 triplet of a dna molecule were atc, list the 3 corresponding bases which will be transcribed
    14·1 answer
  • During strenuous exercise, the NADH formed in the glyceraldehyde 3-phosphate dehydrogenase reaction in skeletal muscle must be r
    14·1 answer
  • What is the most complex level of organization in an organism ?
    10·2 answers
  • Prehistoric remains of animals consist almost exclusively of bones and teeth. Why?
    6·2 answers
  • Please help I’ll give brainist! :)
    9·1 answer
  • Name some organisms that are producers
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!