1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
2 years ago
9

Take Notes

Biology
1 answer:
zloy xaker [14]2 years ago
3 0
Yes I think it is wrong hey I’m going to a party you want to come
You might be interested in
HELP ME!!!!!!
Fed [463]

The answer is...

D) RNA polymerase

3 0
3 years ago
Anyone willing to help? I honestly have no clue what I’m doing..
koban [17]
The youngest would be the ones at the top and the oldest would be at the bottom. the oldest is B and the ones around it, as they get bigger get younger. hope this helps :)
8 0
3 years ago
Please help very easy 5th grade work giving brainliest
strojnjashka [21]

Answer:

pretty sure its A hope this helps!

8 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Which causes a drop in female hormone levels?
qaws [65]

Answer

If the uterine wall thickens

Explanation:

A,B,D, these are all things that happen on a daily to women and most of them still have good horomone levels

6 0
3 years ago
Read 2 more answers
Other questions:
  • Where in plant cells are the energy-absorbing molecules for photosynthesis located? Select one: a. thylakoids b. mitochondria c.
    13·1 answer
  • Is it possible for a woman to have muscular dystrophy? Why or why not?
    7·1 answer
  • Explain why offspring are not clones of each other or their parents.
    15·1 answer
  • How many of each kind of atom is in one molecules of water
    15·2 answers
  • Which statement about life on Earth is true? a)Dinosaurs appeared before insects. b)Dinosaurs and insects appeared at the same t
    6·2 answers
  • What information is coded in the complex molecule?
    8·1 answer
  • What is the function of the excretory system?
    9·1 answer
  • 13. Which of the following would not result in
    15·1 answer
  • A researcher found that the wild species of almond trees contains a chemical called amygdalin.
    6·1 answer
  • Question 1
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!