1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
horsena [70]
3 years ago
15

Particulates can be removed from smokeslack emissions by which of the following methods?

Biology
1 answer:
devlian [24]3 years ago
4 0
Install an electrostatic precipitator (ESP) component, which is a particle control system that helps remove particles from a smokestack by using electrical charges. According to the U.S. Environmental Protection Agency, an ESP can remove small particles with up to 99 percent efficiency.
You might be interested in
Pls help timed test will give brainly to most helpful answer
Darina [25.2K]

both sudden slip on a fault

7 0
3 years ago
Read 2 more answers
HELP FAST!!!
ExtremeBDS [4]

Answer:

I think that it is C

But is am not sure

5 0
3 years ago
Read 2 more answers
Because nadh generated in the cytosol cannot enter the mitochondrion, electrons and protons from nadh are transferred in by ____
klio [65]
I think the correct term to fill in the blanks would be glycerol phosphate electron shuttle. This shuttle is responsible of transporting agents that are reducing into the inner membrane of the mitochondria. Since NADH cannot enter, it is reduced so that the electrons could go in to the transport chain.
5 0
3 years ago
Question 7
Alex

Answer:

Explanation:

False

Elastic collision is one where two colliding particles both lose some of the kinetic energy. gases tend to have lower densities than solids because gases have lower molar mass. ... if a gas and a liquid are both at the same temperature, the particles of gas have a higher average kinetic energy.

8 0
3 years ago
What substance, produced during photosynthes
True [87]

Answer:

Answer is glucose, which is made for plants

5 0
3 years ago
Other questions:
  • Wind can erode rocks, especially in desert areas. Select all the "spheres" that are interacting in this situation.
    10·2 answers
  • What part of a hair is most likely to yield useful dna evidence?
    6·1 answer
  • According to the theory of plate tectonics, which is one feature that plates carry?
    13·2 answers
  • Does when food is eaten affect weight gain? a study was introduced that examined the effect of light at night on weight gain in
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • An experiment that____ a hypothesis will often provide a nee direction for the reseacher
    8·2 answers
  • Which of the following will cause an increase in the weight of an object?
    5·1 answer
  • The production of which substance would most likely indicate anaerobic cellular respiration?
    11·2 answers
  • I don’t know how to answer this question
    12·2 answers
  • Why would one take vitamin supplements?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!