1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
2 years ago
7

Two scientists do not agree which type of grocery bag is better for the environment. What is the most likely outcome of their di

sagreement?
Biology
1 answer:
nika2105 [10]2 years ago
4 0

Answer:

The most likely outcome of their disagreement is the use of cloth tote bags

Explanation:

You might be interested in
Sharks are the top predator in a marine ecosystem. By eating them, sharks maintain a balance in the population of smaller organi
hichkok12 [17]

Answer:

what are the options ??

Explanation:

5 0
3 years ago
What is the process of taking material
solmaris [256]

Answer:

B.

Explanation:

8 0
2 years ago
A teacher says she has identified an organism with these characteristics: eukaryotic, multicellular, autotrophic, and a cell wal
yanalaym [24]
Kingdom plantae is the only kingdom that contains all of those characteristics
7 0
3 years ago
Read 2 more answers
A student drew the following food chain in her science notebook.
laiz [17]

Answer:

B; primary consumers are the ones who eats the producers

7 0
3 years ago
Read 2 more answers
The "diving response" of the human body refers to the typical reaction of a person who submerges his/her face in cold water and
iren2701 [21]
<h2>Diving response</h2>

Explanation:

  • The plunging reaction in human beings is described by breath-holding, easing back of the pulse (jumping bradycardia), decrease of appendage blood stream and a continuous ascent in the mean blood vessel circulatory strain.
  • <em>The bradycardia results from expanded parasympathetic upgrade to the cardiovascular pacemaker.</em>  
  • Hydrostatic weight on the outside of the body because of head out drenching in water causes negative weight breathing which movements blood into the intrathoracic circulation.
3 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A young girl requires a liver transplant due to failure of her liver to function. what is required for her to have a good progno
    13·1 answer
  • The rise of industrialization was accompanied by _____.
    10·2 answers
  • The development of the horse in the fossil record shows
    11·1 answer
  • Genetic engineering is used in the biotechnology industry to?
    8·2 answers
  • If a steam that is septic (anaerobic) receives further human waste containing carbon, nitrogen and sulfur containing materials,
    15·1 answer
  • Why do duplicated cells need to be identical from the original cell? It is more difficult for the organism's body to create a ne
    9·1 answer
  • Theory #1 -Based on the discovery of a 240-million-year-old fossil archosaur, paleontologists theorize that dinosaurs split off
    9·2 answers
  • Trypanosoma is a parasitic protist that causes _______?​
    13·1 answer
  • true or false? local biogeochemical cycles are isolated within their particular ecosystem and all ions and molecules remain in t
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!