Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: I would have to say the living room needs to be cleaned- because a robotic vacuum cleaner.
• Also It could be possible for a hockey player to use bungee cords to keep tension on his/her arms while practicing his/her shot to strengthen it.
We use cell membranes to treat disease because the cell membrane is one of the main barriers that pathogens need to overcome, hindering their replication.
<h3>What is the cell membrane?</h3>
The cell membrane is a thin lipoprotein film formed by phospholipids and proteins delimiting the cytoplasm of all types of cells. They prevent invading microorganisms from attaching to the cell and replicating.
Then, using the concepts of cell membrane, we can use them to prevent viral diseases from occurring since the virus cannot fix itself to replicate. So in this case, the cell membrane is one of the main barriers that pathogens need to overcome, hindering their replication.
See more about cell membrane at brainly.com/question/13524386
#SPJ1
In prophase 1:
Chromosomes become visible, crossing-over occurs, the nucleolus disappears, the meiotic spindle forms, and the nuclear envelope disappears.
In metaphase 1:
The pairs of chromosomes (bivalents) become arranged on the metaphase plate and are attached to the now fully formed meiotic spindle. The centrioles are at opposite poles of the cell.
I hope my answer has come to your help. God bless and have a nice day ahead!
