1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irinina [24]
3 years ago
11

A 1000 kg car speeds up from rest to 25 m/s in 10 seconds.how much force acts on the car?​

Biology
2 answers:
Rina8888 [55]3 years ago
6 0

Answer:

a great week to week to week to week I was

Explanation:

yhbbljgh

katen-ka-za [31]3 years ago
3 0
2500N
Use formula F=ma
* a= v/t
So F= m v/t
F=1000.25/10
F= 2500N
You might be interested in
1. It is the state of matter that is very compressible a. liquid b. solid c. gas d. Plasma NEED HELP GUYS
fomenos

Answer:

C

Explanation:

In general, Gases are the most compressible and solids are the least compressible.

6 0
3 years ago
Read 2 more answers
explain how an ocean current can affect the temperature and the amount of moisture of the air mass anove the current and above n
Anna [14]
It is all connected as current takes place moisture changes
5 0
3 years ago
Suzanne has type A– blood. Which blood type could she receive in a blood transfusion?
Ulleksa [173]

Explanation:

O type blood can be a donor to Suzanne

8 0
4 years ago
Read 2 more answers
The leopard frog and the pickerel frog are two
vichka [17]
A maintain different colored markings on their skinIn areas where
their ranges overlap, the frogs will remain
separate species if they
A maintain different colored markings on their skin
4 0
3 years ago
Read 2 more answers
How does wind form?<br> plz help me asap
muminat
Wind forms when the sun heats up one part of the atmosphere differently that another part.
5 0
3 years ago
Other questions:
  • What is something that is not alive that responds to a stimulus?
    14·2 answers
  • Which best describes the exocrine glands
    11·1 answer
  • a wall on the side of a building is made up of 52 rows of bricks with 44 bricks in each row how many bricks made up the wall
    6·1 answer
  • which of newton’s laws of motions explains why a ball bounces off the ground after it hits the ground
    5·1 answer
  • In multicellular organisms, the process of cell division leads to in the cell number
    12·2 answers
  • Which three planets shown have less gravitational pull than earth
    15·1 answer
  • Explain why some groups doubt the occurrence of global warming and global climate change.
    12·2 answers
  • Estuary ecosystems are important to humans as a source of
    15·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • True or false<br> almost all cells have a nucleus
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!