1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katen-ka-za [31]
3 years ago
12

Solve the problem. Make sure your answer is in simplest form.

Mathematics
2 answers:
krok68 [10]3 years ago
8 0
The answer is 1/28

3/16 * 4/21 = 1/28
Feliz [49]3 years ago
7 0
1/28 is the answer then
You might be interested in
Please help with number 5.<br> Select all that apply.
posledela

Answer: options A, B and C are correct

Step-by-step explanation:

Ray's daily pay,P in dollars is given by the function, p(h) = 10h with h representing the number of hours that he worked on that day. If he worked c hours on Thursday and this is 3 hours more than he worked on Friday, then the following statement is true. We substitute c and c-3 for Thursday and Friday into the given function, p(h) = 10h

A) 10c -3 represents Ray's pay in dollars on Friday.

B) 10c represents Ray's pay in dollars on Thursday.

C) p(c ) - p(c-3) represents how much more Ray's pay was on Thursday than on Friday

8 0
3 years ago
First, drag a value to represent the missing angle in the triangle. Then, complete the trigonometry equality statements.
noname [10]

The missing trigonometric values are listed below:

  • Angle A = 90 - θ
  • sin 28°  =  cos (62°)
  • Cos 33°  =  sin 57°
  • Cos 31°  =  sin 59°
  • Cos (90 - θ) = sin(θ)

<h3>Meaning of Trigonometry</h3>

Trigonometry is a branch of mathematics that studies angles of triangles and its side length.

Trigonometry is so important that every student must come across this branch of mathematics.

In conclusion, the missing trigonometric values are listed above

Learn more about trigonometry: brainly.com/question/24349828

#SPJ1

6 0
2 years ago
PLEASE HELP ME WITH THIS QUESTION!! Thanks
Gre4nikov [31]

Answer:

20% probability

Step-by-step explanation:

First, we need to calculate the area of all the figures inside the rectangle.

Area of triangle= 1/2 BH

So, 3x2=(6)

Area of Square= L^2

3x3=(9)

Area of rectangle= LxW

=60.

60+9+6= 75.

75 is the total area.

Now, lets find the added area of only the triangle and square.

9+6= 15

The probability will be 15/75=

Convert into percent form

= 20%

Hope this helps and please mark me brainliest :)

7 0
2 years ago
What number is half-way between thirteen and thirty-one
mars1129 [50]

\frac{13 + 31}{2} = \frac{44}{2} = 21

Answer: 21

3 0
3 years ago
Which is the length of the third slide of the right triangle
irina [24]

Answer:

27

Step-by-step explanation:

if you do pathagorean therom

8 0
3 years ago
Other questions:
  • 4/9(y+3)=g solve for y
    9·1 answer
  • Cards numbered 1 through 15 are mixed up and placed in a bag. Malik chooses one of the cards without looking. What is the probab
    5·2 answers
  • f a rectangle has a perimeter of 70, a length of x and a width of x - 9, find the value of the length of the rectangle.
    10·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Please help me with my math question!!
    7·1 answer
  • PLEASE HELP I GIVE A DECENT AMOUNT OF POINTS !!The circumference of the outside of a ring is 66 mm, and it has an outer diameter
    13·1 answer
  • Is the graph increasing, decreasing, or constant?
    10·1 answer
  • Janine has job offers at two companies. One
    12·1 answer
  • PLEASE HELP ASAP &lt;3 <br> Evaluate: 23+x/8 for x = 8<br> O 24<br> O 3.875<br> O 20<br> O 18
    7·1 answer
  • complete mapping of the vertices of DEF what is the rule that describes a reflection across the line y=x
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!