1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aliun [14]
3 years ago
15

What are three characteristics of carbon that make it a unique element?

Biology
2 answers:
Sonbull [250]3 years ago
5 0
The answer provided already is satisfying but gives only one unique property of carbon.
One, as already mentioned, its ability to form various types of bonds as it is found in inorganic materials, but also is the very base of organic sciences.
The second I would say, is that it forms the 2 most opposite materials found, diamond which is unbreakable under normal conditions and also graphite which is super weak and fragile. and the only difference to make them is the condition of temp. and pressure that they were created in. Knowing that graphite is one of the best materials used in nano-sciences for its great shear-tensile behavior.
The third one will be its abundance I believe.
I also believe that someone else might say different 3 points depending on how they use or study Carbon or their background of its wide uses.
egoroff_w [7]3 years ago
4 0
The answer lies with carbon's unique properties. Carbon has an exceptional ability to bind with a wide variety of other elements. Carbon makes four electrons available to form covalent chemical bonds, allowing carbon atoms to form multiple stable bonds with other small atoms, including hydrogen, oxygen, and nitrogen.
You might be interested in
Name ALL the alleles that control human blood groups.​
Naily [24]

Human blood groups are governed by three alleles. These are called I A ; I B ; I O .

I B shows the codominance

I O is recessive to both other alleles

8 0
2 years ago
What is the role of ATP synthase in photosynthesis?
german

The role of ATP synthase in photosynthesis is to transports a proton down the gradient and uses the energy to complete the phosphorylation of ADP to ATP.

Further Explanation:

Photosynthesis starts with the absorption of light or solar energy by the plant pigments called chlorophyll. The activated chlorophyll molecule helps in the electron transfer from one acceptor to another forming a chain.

The first phase of photosynthesis the light-dependent reaction in which the absorbed light is utilized to produce molecules carrying energy that is used in the second phase to form carbohydrates by reducing carbon dioxide. The first phase occurs in the grana region of the chloroplast and involves the transport of electrons through photosystem II (PS II) followed by photosystem I (PS I). The energy gained by the chlorophyll molecule is transferred to PS II in the form of electrons. These electrons are passed on further through a series of electron transporter or carrier from PS II to PS I. In photosystem I, finally, the electron is gained by NADP+ to form NADPH.

The ATP synthesis is produced by the use of proton motive force this reaction is catalyzed by ATP synthase. This a multiprotein synthase is also well-known as F0 F1 complex .The ATP molecule is synthesized when proton flow back from the inner membrane down the electrochemical proton gradient . ATP synthase has two components F1 ATPase and F0 which is embedded in the inner membrane and contain alpha, beta and C unit.

As the electrons travel along the electron transport chain, energy is released which helps in the pumping of protons (ions) into the lumen from the stroma through the thylakoid membrane. A proton gradient is developed which allows the movement of protons back to the stroma which in turn results in the formation of ATP through membrane-bound ATP synthase

The second phase of the photosynthesis is the dark reaction or the light-independent reaction happens in the stroma and utilizes the products formed during the light-dependent phase.

Learn more:

  1. Learn more about cell organelle <u>brainly.com/question/5923583 </u>
  2. Learn more about the diffusion <u>brainly.com/question/1386629</u>
  3. Learn more about the plant <u>brainly.com/question/862697 </u>

<u> </u>

Answer Details:

Grade: High School

Subject: Biology

Chapter: Plant Cell

Keywords:

ATP synthase, light dependent reaction, thylakoid, stroma, grana, membrane, photosynthesis, alpha , beta, proton motive force.

5 0
3 years ago
Read 2 more answers
Compared to a light colored rock with a smooth surface, a dark colored rock with a rough surface will
AlexFokin [52]
Absorb more thermal energy, and the rough surface will prevent it to reflect efficiently.
3 0
3 years ago
Which level is most commonly meant by biodiversity
Rus_ich [418]
The level most commonly meant by the term biodiversity is the species level.
6 0
3 years ago
Which organelle performs a similar function in humans at the cellular level?
soldier1979 [14.2K]

Full Question found elsewhere

The human body processes and eliminates food waste using the organs of the excretory system. Which organelle performs a similar function in humans at the cellular level?

Answer:

Lysosome

Explanation:

The lysosome is a part of the endomembrane system. It is a series of sacs containing digestive enzymes that are surrounded by membranes. Lysosomes are produced by the Golgi apparatus. They break down waste products so some components can be released outside the cell and others can be recycled.

4 0
3 years ago
Other questions:
  • What state is farthest north in the Chesapeake bay watershed
    12·1 answer
  • The typical state of a neuron is the _____ potential, but when electrical signals stimulate it to its threshold, the _____ is im
    13·1 answer
  • Explain why it is necessary to use the same restriction enzyme to cut the desired gene from the source and to cut the plasmid. I
    13·1 answer
  • Banana plants grown for food crops are the result of asexual reproduction. Does the genetic information of each plant come from
    7·1 answer
  • Which job would likely be best for a person who is technically oriented rather than clinically oriented?
    7·1 answer
  • Diego is studying compost. He conducted an experiment to see how moisture levels affect the breakdown of organic materials in co
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • List three potential benefits of the selective breeding of animals, such as cattle and goats.
    6·1 answer
  • Match the organelle with its function.
    8·1 answer
  • The list shows four metabolic processes.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!