We have 600 grams of grass, which has 450 grams of water. This means that there are 600 - 450 = 150 grams of dry weight (aka dry grass without any water)
20% of the dry weight is the amount of protein the rabbit gets
20% of dry weight = 20% of 150 = (20/100)*150 = 0.20*150 = 30
<h3>Answer: The rabbit eats 30 grams of protein per day</h3>
If you look at a map it will show that the Gulf of Mexico touches all of them
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Green year round
You can search for the definition of deciduous trees for proof
