1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka21 [38]
4 years ago
15

Which of these fields is used to classify organisms A. taxonomy B. botany C. genetics D. anthropology.

Biology
1 answer:
allsm [11]4 years ago
7 0
Correct answwer is A
You might be interested in
Sorry but I am bad at biology
Nimfa-mama [501]

We have 600 grams of grass, which has 450 grams of water. This means that there are 600 - 450 = 150 grams of dry weight (aka dry grass without any water)

20% of the dry weight is the amount of protein the rabbit gets

20% of dry weight = 20% of 150 = (20/100)*150 = 0.20*150 = 30

<h3>Answer: The rabbit eats 30 grams of protein per day</h3>
3 0
3 years ago
This body of water touches Mexico and the American State of texas,louisiana, Mississippi, Alabama, and Florida
jek_recluse [69]
If you look at a map it will show that the Gulf of Mexico touches all of them
4 0
4 years ago
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′
Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0
4 years ago
Francis was frightened by a clown at his birthday party when he turned six years old. At the age of eight he still becomes highl
emmasim [6.3K]

Answer:

Specific phobia

Explanation:

  • Diagnostic and Statistical Manual of Mental Disorders, 4th Edition, Text Revision gives a classification of recognised mental health disorders in the form of DSM-IV codes.
  • The fear of clowns is described as a specific phobia with a code of 300.29.
  • A specific phobia is a fear that lacks a reason or rational against an exposure to a certain object or situation.
  • Such specific phobias can leads to a disability in normal life as people suffering from such phobias tend to avoid situations where they may encounter such phobias.
  • The fear of clowns is known as Coulrophobia which is a type of specific phobia when it interferes with the normal functioning and is persistent.
  • Since Francis becomes anxious upon seeing a clown since he was 6 years old and the fear persists and he avoids going to places where he sees clowns, he has specific phobia against clowns.

6 0
3 years ago
Organisms that live in deciduous forests have developed unique adaptations that aid in their survival. Which of the following is
Aneli [31]
Green year round

You can search for the definition of deciduous trees for proof
8 0
2 years ago
Other questions:
  • Protists are helpful to us because they?
    14·1 answer
  • The temperature in a water bath holding a flask in which a reaction is occurring changes from 22°C to 23°C over a period of 2 mi
    9·1 answer
  • The colors of peacocks and hummingbirds are the result, not of pigments, but of ridges in the surface layers of their feathers.
    5·1 answer
  • Which statement describes a similarity between the calcium pump and the sodium-potassium pump? Both pumps move substances from h
    7·2 answers
  • Which trophic level does a fish represent in food chain?
    10·1 answer
  • If a uniform becomes saturated with blood, what is the proper action that should be taken for the athlete to continue participat
    6·1 answer
  • Where do landslides strike
    13·2 answers
  • A study shows that a new pesticide is safe for use on food crops. The researcher who conducted
    7·1 answer
  • Why is photosynthesis so important to living organisms?
    8·1 answer
  • What is nectar and what animals are attracted to it.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!