1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio039 [100]
3 years ago
10

8 Galileo Galilei discovered that the planet Venus

Biology
2 answers:
Anna35 [415]3 years ago
5 0

Answer:

venus orbits the sun

hope this helps

have a good day :)

Explanation:

Juliette [100K]3 years ago
3 0

Answer:

I. Venus orbits the sun...

Explanation:

You might be interested in
How is a scientific theory different from everyday theories proposed by random individuals?
Alex17521 [72]

Answer:

D

Explanation:

4 0
4 years ago
Read 2 more answers
Which will form an ionic bond
tia_tia [17]
A Non-metal and a Metal react together to form an ionic bond
metals lose electrons to match the numbers of their nearest noble gas
6 0
3 years ago
Read 2 more answers
Briefly describe the chicken experiment. Why is it relevant?
vesna_86 [32]
<span>The chicken experiment serves to explain how behavioral conditioning may be applied to any species. By identifying an appropriate reward for the subject in question, that subject may be taught any physically possible random behavior. Then, if witnessed, the behavior is able to be learned and mimicked by other members of the same or even different species.</span>
7 0
4 years ago
In mitosis of a single cell, what happens to the nucleus
Readme [11.4K]
A unique feature of the nucleus is that it disassembles and re-forms each time mostcells divide. At the beginning of mitosis, the chromosomes condense, the nucleolus disappears, and the nuclear envelope breaks down, resulting in the release of most of the contents of the nucleus into the cytoplasm.
Hope that helped
3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • The _______ is the body's slow-acting control system and acts by means of _______.
    7·1 answer
  • What is the key term for the mass of bacteria that forms when bacteria are grown on agar?
    15·1 answer
  • When exercising,you should
    15·2 answers
  • You're trying to identify a plant, but have no information on its characteristics, other than the fact
    9·1 answer
  • The fish will not survive if light is unavailable to this ecosystem. explain why
    15·1 answer
  • Elias conducted an experiment about the effects of exercise on the heart rate of teenagers. Before morning basketball practice,
    15·1 answer
  • Why are models important ?
    9·1 answer
  • Do you wanna go plant tulips with me
    8·1 answer
  • Name 2 reasons why bacteria are resistant to antibiotics?
    10·1 answer
  • Before tbp is loaded, which taf blocks the dna binding cleft of tbp and the n-terminal stirrup?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!