1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miskamm [114]
3 years ago
9

Which argument is BEST supported by the

Biology
1 answer:
klasskru [66]3 years ago
5 0

Answer:

B

Explanation:

It tells us a lot about why the argument is correct.

You might be interested in
State two types of membranes​
Jobisdone [24]

Answer:

Epithelial Membranes & Mucous Membrane

pls mark as brainliest and follow me... i will follow back

8 0
2 years ago
Read 2 more answers
1. Define fitness as it used to describe adaptation
aliya0001 [1]

Answer:

In terms of adaptation, fitness refers to the ability of an organism to survive and reproduce in a constantly changing environment.

Adaptive traits are very much important in a constantly changing environment as they increase the chances of survival of a population in the environment.

For example, Darwin's finches adapted to develop different types of beaks in order to get nutrition in different environments. Long necks of giraffes are also considered as a result of adaptation which helps them get the food located high on trees.

3 0
3 years ago
Can anyone pleasee help me with this question?
Veseljchak [2.6K]
I might be wrong but soil?
8 0
3 years ago
Discuss the significance of family in the life of the adult​
blondinia [14]

Explanation:

Family is important because it provides love, support and a framework of values to each of its members. Family members teach each other, serve one another and share life's joys and sorrows. Families provide a setting for personal growth. Family is the single most important influence in a child's life.

8 0
3 years ago
Which of the following mutations is NOT a point mutation? A. Silent mutation B. Nonsense mutation C. Missense mutation D. Insert
JulsSmile [24]

the answer is Insertion mutation :)

(search up "types of mutations")

8 0
4 years ago
Other questions:
  • How are the weak and the strong forces alike?
    12·2 answers
  • How do immunoglobulin genes code for a seemingly infinite variety of antibodies?
    8·1 answer
  • The mucosa of the appendix contains masses of lymphoid tissue (MALT) and therefore leukocytes capable of attacking bacteria are
    9·1 answer
  • You exercise at home every day by running around the block. you know that the distance around the block is equal to 3000 feet.
    8·1 answer
  • Ashfaq, is asked to explain the difference between a hypothesis theory and a scientific law which are terms used when discussing
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • You dilute an original sample 1:30. You then count the number of yeast in the 1:30 dilution. You count an average of 7 cells in
    14·1 answer
  • What average speed, most nearly, is required to run a 4 minute mile? (1 mile = 1.609 km), (1 min = 60 seconds), (Av Speed = Dist
    14·1 answer
  • Trace fossils are not actual pieces, molds or impressions of organisms.<br> O True<br> O False
    14·2 answers
  • This is for biology 1 please answer the question.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!