1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PilotLPTM [1.2K]
3 years ago
7

Which situation would most likely result in evolution due to an allele frequency change?

Biology
1 answer:
Maru [420]3 years ago
8 0

Answer:

A-A population of butterflies includes alleles for both yellow and green butterflies. A butterfly predator sees yellow more easily than it does green

Explanation:

You might be interested in
What is the process by which a species becomes better suited in its environment?
Otrada [13]
Adaptation is the process by which become suited to their environment
8 0
4 years ago
Read 2 more answers
A gecko is a type of reptile. How does a gecko most likely respond to cold air temperatures?
GuDViN [60]

Answer:

by moving into the sun which is in response to an external stimulus

Explanation:

The geco will want to get warm as a result of the cold air which is an external stimulus so it moves into the sun

8 0
3 years ago
What do glycolysis, the citric acid cycle, and the electron transport chain have in common?
professor190 [17]

Answer:

A

Explanation:

Cellular respiration is the metabolic process in which oxygen is used to breakdown carbohydrates, fats and proteins to generate adenosine triphosphate (ATP). Mitochondria are the ‘engine room’ of eukaryotic organisms, as they are the main site of cellular respiration.

6 0
3 years ago
Read 2 more answers
PLEASE ANSWER ASAP!!
OverLord2011 [107]

Answer:

changing environment

Explanation:

If the species fails to adapt, it will die off.

5 0
3 years ago
Read 2 more answers
Long chains of amino acids are found in what?
timofeeve [1]

Amino acids bond together to make long chains. Those long chains of amino acids are also called proteins.

Hope this helps!

6 0
3 years ago
Other questions:
  • Which of the following is the best example of a community?
    9·2 answers
  • The best description of the greenhouse effect is that it _______.
    15·1 answer
  • One characteristic used to place organisms into kingdoms is blank
    11·1 answer
  • What refers to the shape that be observed using microscope
    15·1 answer
  • Correctly label these important genetic terms as seen in this Punnett square.
    8·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • 7- Describe in brief the
    8·1 answer
  • True or False: Homologous structures indicate a shared ancestry but<br> vestigial structures do not
    12·1 answer
  • In the 4th stage of the software development life cycle, you begin to program the software. What is this stage of the cycle call
    8·1 answer
  • ______________ are cycles of materials through the biotic and abiotic components of earth.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!