1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iVinArrow [24]
3 years ago
15

The ability not to taste PTC is dependent on recessive gene (t).

Biology
1 answer:
yKpoI14uk [10]3 years ago
3 0
Would say it would be a
You might be interested in
Pleaseeee help!!!!!!!! I will mark you as brainlinest for correct answer!!!!!!!!!!
kolezko [41]
THE ANSWER IS THE THIRD ONE

7 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
How come one type of matter can be converted to a totally different one?
wariber [46]

Answer:

Explanation:

En física, la materia es todo aquello que se extiende en cierta región del espacio-tiempo, que posee energía y está sujeto a cambios en el tiempo y a interacciones con aparatos de medida. Se considera que es lo que forma la parte sensible de los objetos perceptibles o detectables por medios físicos.

Etimológicamente, proviene del latín materia, que significa «sustancia de la que están hechas las cosas» y que también alude a la «madera dura del interior de un árbol»;1​ la palabra está relacionada con māter («origen, fuente, madre»)2​ y se corresponde con el griego hyle3​ (de hylos: «bosque, madera, leña, material»)4​5​ que es un concepto aristotélico de la teoría filosófica del hilemorfismo.6​

El uso moderno del término va más allá de la noción clásica de sustancia, y los físicos denominan materia a cualquier entidad cuya presencia en una cierta región del espacio-tiempo conlleva que el tensor energía-impulso para dicha región es diferente de cero.

8 0
3 years ago
I offer (20pts) The role of an enzyme in chemical reaction is to change which of the following?
ki77a [65]

The role of an enzyme is to B change the activation energy of the reaction. Specifically, they increase the general speed of all reactions and are made of proteins.

7 0
3 years ago
Carol is having a hard time attracting hummingbirds to her new feeder location. She is not sure if the reason is that the hummin
exis [7]

Answer:

She should hang up a feeder of the old food next to the feeder of new food to test which one they really like more.

7 0
3 years ago
Other questions:
  • QUESTION 16 Each codon in a sequence code for what?
    13·1 answer
  • Which of the following animals does not lay eggs? Spiny anteater Robin Leopard Frog
    15·2 answers
  • Most animal cells are bathed in an isotonic fluid, such as blood, which protects them from bursting. How does an isotonic soluti
    6·1 answer
  • Peripheral nervous system consists of​
    9·1 answer
  • Dr. Flores wants to know which of the forum claims is best supported by the evidence you have gathered from your previous Sim ob
    5·2 answers
  • Which of the following is the most important reason to maintain a high level of cardiovascular health?
    14·1 answer
  • What is:<br> Behavioral isolation Temporal Isolation <br> Habitat Isolation
    14·1 answer
  • Describe the process that leads to a liner pattern of calderas
    12·1 answer
  • 3. Climate change has been a topic repeatedly mentioned in our study of Marine Science.
    6·1 answer
  • On which of these issues did Lamarck and Darwin have similar views ?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!