1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
3 years ago
13

What Occurs when the agents of erosion (water, wind, ice, gravity) slow down

Biology
1 answer:
bulgar [2K]3 years ago
3 0

Answer:

then landscape would rarely happens and the there will be a lot of rocks  smooth surface

Explanation:i really don't know

You might be interested in
What words describe the outer planets? Select two options.
myrzilka [38]
The correct answer is A
4 0
3 years ago
Read 2 more answers
suggest and explain how the flow of blood in a person with patent ductus arteriosus differs from that of a person with a healthy
iren2701 [21]
Ductus Arteriosus is a blood vessel normally present in fetuses during development. The blood vessel is designed to bypass the pulmonary artery and brings blood to the Descending Aorta, as the fetus cannot breath through the lung (being as they are fluid filled). This is normally not a problem because oxygenated blood comes from the mother's blood supply.

Patent Ductus Arteriosus, is what happens when that vessel does not close. While not as dangerous as other congenital defects. However, because there is still a bypass, blood that normally need to be oxygenated by going through the pulmonary arteries to the lungs, can be diverted and placed into the blood stream without vital oxygen. This condition may eventually lead to CHF (congestive Heart Failure) and Pulmonary Hypertension if not treated.
6 0
3 years ago
Flatworms are
svetoff [14.1K]
Flatworm<span>, also called platyhelminth, any of the phylum Platyhelminthes, a group of soft-bodied, usually much flattened invertebrates. A number of </span>flatworm<span> species are free-living, but about 80 percent of all </span>flatworms are<span> parasitic—i.e., living on or in another organism and securing nourishment from it.</span>
5 0
3 years ago
Sucrose is made of which simple sugars?
Nadya [2.5K]

Answer:

it is made of

glucose and fructose.

5 0
3 years ago
Read 2 more answers
Bacterias extintas y sus causas​
slavikrds [6]

Answer:

Las bacterias se extinguen a tasas sustanciales, aunque parecen evitar las extinciones masivas que han venido afectando a formas de vida más grandes en la Tierra.

Explanation:

hope this help u..

7 0
3 years ago
Other questions:
  • What is a method of food preservation that involves placing food in vinegar or a salt solution?
    5·1 answer
  • What are some names of deadly bacteria ?
    6·2 answers
  • what were some of the strange and unexpected things that scientists discovered when they analyzed the human genome? (the video)
    9·1 answer
  • What is the green house effect?
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Calculate the average pulse rate before exercise for this group, to the nearest tenth
    13·2 answers
  • Hi! i’ll give brainliest please help
    15·1 answer
  • Animals release _____ into the atmosphere through _____
    14·2 answers
  • Hi please please help<br>​
    8·1 answer
  • How many times does a cell<br> divide during mitosis?<br> A. twice<br> B. once<br> C. three times
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!