1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rosijanka [135]
3 years ago
13

What are the advantages and disadvantages of using RNA or protein as genetic material?

Biology
1 answer:
larisa86 [58]3 years ago
7 0

The most important idea is that the genetic material of any organism must be able to accurately replicate itself at least every generation (or for multicellular organisms at each cell division).  

Base pairing (A-T or U and C-G)allows DNA and RNA (eg in polio virus, see Wikipedia page on RNA dependent RNA polymerase) to create a copy of themselves, when the appropriate enzymes are present. Proteins have no way of making a copy of themselves.  

Stability is probably the main reason DNA is the most common genetic material. DNA has no enzymatic activity and was probably selected for to maintain the integrity of the genetic material (rather than having to perform a function for the cell/virus, during which it may be destroyed). The double helix structure also protects its integrity, and proofreading enzymes have also evolved which correct most of the mistakes made at DNA replication. RNA viruses don't have this mechanism- which could be said to be an advantage (as they can rapidly change and therefore avoid their hosts' immune systems), however in non-parasitic organisms most mutations in a gene would lead to a loss of an essential function and the extinction of that genome.  

I don't think either of these reasons are relevant, but I think the main reasons retroviruses convert their RNA to DNA are so they can use the host cell's replication machinery (this was they do not need to encode as many genes), and secondly they need avoid the antiviral mechanisms of the cell, which would destroy any double stranded RNA molecules found (even if the virus was single stranded, dsRNA would have to be produced at replication).  

You might be interested in
Question: What is the effect of day length on plant growth?
Olegator [25]
Your hypothesis is incorrect considering every day has the same length to it. 
5 0
3 years ago
Read 2 more answers
Women who take fertility drugs to assist in becoming pregnant have increased chances of giving birth to
Nata [24]

The correct answer is option (d) that is dizygotic twins.

The dizygotic twins also known as non-identical twins or fraternal twins, that is, two siblings who come from distinct eggs or ova, which are discharged at the similar time from an ovary and are fertilized by different sperm.

4 0
3 years ago
Which of the following is true about the cells of an animal’s body?
azamat

Answer:

D

Explanation:

5 0
3 years ago
T or F : HIV is able to make copies of itself without the aid of another organism
katrin [286]

Answer: False. HIV cannot reproduce on its own.

6 0
2 years ago
Read 2 more answers
Yeast is a fungus and it can die. Bakers proof yeast to make sure it will respond and rise. A student tests different ways to pr
ruslelena [56]
B. Yeast responds to added sugar
4 0
3 years ago
Read 2 more answers
Other questions:
  • 4. What are some of the hazards that domestic pets like dogs and cats can experience in regard to poisons? How are pets exposed
    5·1 answer
  • Where does glucose, galactose, fructose, and sucrose come from?
    10·1 answer
  • Why do sperm cells contain so many mitochondria?
    12·1 answer
  • 20 POINTS!!<br> A _______ bond forms when two atoms share one or more pairs of electrons.
    7·2 answers
  • Why do breeders look at pedigrees before breeding dogs? Or in different words, how do pedigrees play a part in breeding dogs?
    5·1 answer
  • An object with a mass of 2.0 kg has a force of 4.0 Newtons applied to it. What is the resulting acceleration of the object?
    11·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • (GIVING BRAINLIEST AND EXTRA POINTSS!!!!)
    15·1 answer
  • One of factor that influence the absorption water and mineral salt in plant is .....
    11·1 answer
  • Which of the following is not a defining charecteristics of plants ?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!