1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana [24]
3 years ago
6

To measure gas in a car by unit what would you measure by? Cup?Pint?Quart?or gallon.

Biology
2 answers:
mylen [45]3 years ago
8 0

Answer:

Gallon

Explanation:

Sedbober [7]3 years ago
5 0
Gallons. You buy gasoline by the gallon.
You might be interested in
Pros and cons of the crude oil process​
kirill115 [55]
<h2><em>Pros</em></h2><h2>- Oil Has Lots of Use</h2><h2>- Crude Oil Can Be Stored Easily</h2><h2>- The Oil Industry Creates Jobs</h2><h2 /><h2>Cons </h2><h2>- Oil Energy Produces Toxic Gases</h2><h2>- Oil Leaks Are Possible</h2><h2>- Drilling For Oil Is Dangerous</h2>
6 0
3 years ago
Because Bloede dam was no longer functioning as a hydroelectric generation plant it was an easy environmental decision to remove
diamong [38]

Answer:

Explanation: It depends can the electricity be produced with solar power

or wind power. If fossil fuels are only way to replace power produced by

hydroelectric power, it is not advisable not to take it off production.

Somewhere certain stairs or bypasses are done to fishes which are going upstream.

3 0
3 years ago
⚠️⚠️⚠️⚠️ Identify the correct statement about the diagrams about ⚠️⚠️⚠️⚠️
Ratling [72]

Answer:

D

Explanation:

3 0
3 years ago
For each of the following nitrogenous base sequences, write the complimentary sequence on the line provided.
azamat
A) TAGGATCTTCCA
b)GCAACGTCTTGA
c)ATGCCTAGCAGT
8 0
3 years ago
This is a biology question I have, What is happening in this image?
Alexeev081 [22]
I don’t really understand the question but i’m assuming that’s there’s a chemical reaction happening when the bicyclist is eating the food to get energy to bike?
7 0
3 years ago
Other questions:
  • What are five major types of cloud
    7·2 answers
  • Amy quickly becomes the center of attention when she enters a room. She is a tall and attractive young woman who generally wears
    5·1 answer
  • Psychological stress can increase a person’s susceptibility to disease.
    6·2 answers
  • What is basis for all scientific explanations
    12·1 answer
  • ¿cuáles son las diferencias entre una célula procariota y una eucariota? <br>plis ayúdenme ​
    10·2 answers
  • Question 10 5 pts Live or Die challenge (multiple answers): you are walking in the woods just with water and a Black Bear lookin
    11·1 answer
  • 2. About how often does a Full Moon happen?
    9·2 answers
  • A hydraulic system uses a(n) ____________________ to transmit pressure.
    9·2 answers
  • An organism with a mutated cell
    6·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!