Answer:
homologous chromosomes
Explanation:
Homologous chromosomes are the same length and have specific nucleotide segments called genes in exactly the same location, or locus.
It is crucial that the process of mitosis is error free. This is because other wise healthy cells can become cancer cells since mitosis deals with the whole human reproduction thing, its best to keep it clean so nothing happens to the healthy cells or else it can be infected and possibly harm a person/baby.
Basically ionic bonds can be formed between a metal atom and something called a radical ion. The radical ion could have covalent bonds within themselves, for example, CO3- is a radical ion.
It should be
AGATACCATGGTTACCCGGTTCCA
Answer:
50%
Explanation:
(TT) Is fully tall. (TS) Is medium. So it can be assumed that (SS) is short. When forming a cross, you cross TT and TS to generate a phenotypic ratio of 1x1 or a genotypic ratio of 1 TT, 1 TS. Making it exactly split in half in 50/100.
Hope this helps!
