1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
strojnjashka [21]
3 years ago
8

9 Luis wants to interview someone who has a career in biotechnology. Which of

Biology
1 answer:
Pachacha [2.7K]3 years ago
6 0
Bio refers to study of living things + technology (is pretty straightforward- i dont think i need to explain this)

This means Vincent modifies the DNA of bacteria to study the function of their genes is the correct answer :)
You might be interested in
The diagram shows a sponge.
enot [183]

Answer:

fertilizing eggs

Explanation:

5 0
3 years ago
Read 2 more answers
Glucose belongs to which category of organic compound?
Vikki [24]

Answer:

B.

Explanation:

5 0
3 years ago
Read 2 more answers
In the periodic table, Groups are_____ columns.
AnnZ [28]

Answer:

Vertical

Explanation:

Biology class :)

8 0
3 years ago
A key feature of animal body plans is that they can show multiple types of symmetry.For example,,a dog would represent bilateral
Stella [2.4K]

Answer:

A key feature of animal body plans is that they can show multiple types of symmetry.For example,,a dog would represent bilateral symmetry,while a jellyfish and other cnidarians would represent <u><em>radial symmetry</em></u>.

Explanation:

In biology, symmetry can be described as the balanced distribution of the body shape of an organism.

Radial symmetry can be described as a symmetry which depends on a central axis. The symmetry of cnidarians depends on a central axis hence they have radial symmetry.

Bilateral symmetry can be described as a symmetry in which the two halves of the symmetry are mirror images of one another. For example, humans, dogs etc.

6 0
3 years ago
The part of an experiment that stays the same though out the experiment is called a
Eddi Din [679]
Answer is: the part of an experiment that stays the same though out the experiment is constant.
<span>Constant is a quantity that does not change.
</span>Experimental variable<span>, which is the also part of an experiment, is affected by the experiment (have change).</span>
8 0
3 years ago
Other questions:
  • Which renewable resources can become non-renewable if mismanaged
    6·1 answer
  • What does not exist in a supersaturated solution
    7·2 answers
  • Over the past​ half-century in the united​ states, health care spending has​ ________ and health care outcomes have​ ________.
    6·1 answer
  • What are chromosomes
    14·2 answers
  • What is produced when a yeast cell undergoes fermentation?
    15·2 answers
  • Why is a year on saturn so much longer than a year on earth?
    5·1 answer
  • Which of the following cases represents the phenomenon of contact inhibition? a. Healing of an injury b. Growth of a tumor c. Tu
    15·1 answer
  • During the process of fertilization, a haploid egg cell fuses with a haploid sperm cell. The nuclei of the cells fuse, and the
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • high efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!