1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
3 years ago
13

Explain how DNA is used to make a protein.

Biology
1 answer:
Bad White [126]3 years ago
3 0

Answer:

DNA starts off on the nucleus where it then gets separated into DRNA so that it can travel to other parts of the cell. It is the. Carried by vehicle to the rough ER where ribosomes are added to it then it goes to the smooth ER where waste is expelled. Finally, it goes to the Golgi apparatus where it is either stored or carried to a part of the cell.

Explanation:

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which example of artificial selection is caused indirectly by human activity?
Elena-2011 [213]
The answer iscreased
4 0
3 years ago
The French scientist Jacques Monod famously said, "Anything found to be true of E. Coli must also be true of elephants." How is
8090 [49]

Answer:

The correct answer is : prokaryotic organisms like E. coli and higher organisms share common ancestor.

Explanation:

E. Coli is a prokaryotic organism or bacteria. On the metabolic level these organisms share similar homology with the higher organism other than this these organisms also show same core functions with higher level organisms such as elephant.

These similarities suggest that the all the living organisms share a common ancestor. The french scientist Jacques Monod statement "Anything found to be true of E. Coli must also be true of elephants." is also based on this notion.

3 0
3 years ago
Match the planets to its description, Jupiter, Saturn, Uranus, Neptune?
olga_2 [115]

Answer:

Jupiter, Saturn, Uranus, Neptune

Explanation:

Jupiter, Saturn, Uranus, Neptune

3 0
3 years ago
What is the Difference between DNA &amp; RNA?
Travka [436]
DNA is deoxyribonucleic acid while RNA is ribonucleic acid !

DNA has base pair of adenine guanine thymine and cytosine.....while RNA has adenine guanine cytosine and uracil !

DNA is always double helix while RNA is mainly single helix !

DNA contains genetic info for 99℅ of organism while RNA is being catalytic and unstable than DNA is only present as genetic information holder in 1℅ !

DNA does not involve in protein synthesis directly but RNA has to !

for more difference, comment !
8 0
3 years ago
Other questions:
  • Diastolic describes a measurement of which of the following?
    15·2 answers
  • Chemical receptors in the ______ of the brain regulate unconscious breathing.
    13·1 answer
  • HELP PLATO QUESTION BIOLOGY..
    11·1 answer
  • Define adaptation as a change that improves the change of survival for a species in a specific environment
    9·1 answer
  • Name and describe all the ways carbon enters the atmosphere.
    15·2 answers
  • Glucose is stored energy and ATP is right now energy. How does ATP provide energy to your body?
    8·1 answer
  • How do high levels of carbonic acid detection trigger a negative feedback loop?
    11·1 answer
  • Why are bio engineers interested in viruses?
    11·1 answer
  • What two components are often found as part of<br> an enzyme?
    5·1 answer
  • Can someone help me with this please! Asap
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!