1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OlgaM077 [116]
3 years ago
6

Each gene controls the production of one or more specific

Biology
1 answer:
Oduvanchick [21]3 years ago
6 0
True. Have a good daub
You might be interested in
Over many generations darker for color becomes more common in a population of squirrels living in a shady area
PIT_PIT [208]

The answer is letter b. adaptation. Adaptation occurs when living organisms adapt to their surroundings or environment over a long period of time. In this case, Dark Furred Squirrels were abundant, since squirrels adapted to the dark shady area they have lived and adapted into a dark furred one, which allowed it to be more common due to adaptation.



7 0
3 years ago
Red rose color is incompletely dominant over white rose color. If a red rose is crossed with a pink rose, what percentage of the
Bond [772]
"50" percent of the offspring will be pink is the one among the following choices given in the question that will happen if <span>a red rose is crossed with a pink rose. The correct option among all the options that are given in the question is the third option or option "C". I hope the answer has helped you.</span>
7 0
3 years ago
Which line points to the myelin sheath?
UkoKoshka [18]
4.

Myelin Sheath is an insulator on the axon

Hope that helps! :)
8 0
3 years ago
How long are dogs pregnant?
zhannawk [14.2K]
It's 58 to 68 days
It is known as Gestation period
3 0
3 years ago
Please answer right! thanks ​
cestrela7 [59]

Answer:

It develops over land and is cold and dry!

Explanation:

It's a continental air mass, so it develops over land! Maritime ones develop over water. It's cold and dry because it's a polar air mass, not tropical!

I hope that helped you!

6 0
3 years ago
Other questions:
  • In which environment are you most likely to find animals that employ uric acid as their primary form of nitrogenous waste?
    15·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Cells from advanced malignant tumors often have very abnormal chromosomes as well as an abnormal number of chromosomes. what mig
    5·1 answer
  • The way plant shoots grow toward the light
    5·1 answer
  • System that serves as a barrier against infection and injury
    6·2 answers
  • Everything in the universe is composed of energy and matter. Which one of these examples does not represent matter? * An atom of
    11·1 answer
  • An experiment testing the hypothesis that nitrogen markers shoot farther than carbon dioxide markers resulted in conflicting tes
    7·1 answer
  • What are the reactants in the equation for cellular respiration A.Oxygen and lactic acid B.Carbon dioxide and water C.Glucose an
    6·1 answer
  • Compared to a solution of PH3 a solution of pH one is
    11·1 answer
  • What is the possible plan of action? (About landslide reasearch)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!