1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
10

How are the asthenosphere and the lithosphere different?

Biology
1 answer:
Rashid [163]3 years ago
8 0
Earths lithospere is solid and sits on top of the softer asthenosphere.
You might be interested in
Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional
irga5000 [103]

Answer:

By avoiding the factors due to which the disease occurs.

Explanation:

Seniors can combat health problems they may face by avoiding the factors which contribute in that health problems. For example, chronic disease occurs when the individual consume foods with more cholesterol so for reducing the risk of this disease the person should avoid the intake of food with high cholesterol levels. If they don't avoid the intake of  such type of food so this disease may lead to death by closing the valves of the heart.

7 0
4 years ago
Why can diamonds form in the mantle?
bonufazy [111]

Answer:

Diamonds cam form in the mantle because of the impact of the weight of the overlying rock which bears down on it, in combination with the high temperature of the area where they are formed (about 100 miles beneath the surface). Therefore,  the correct answer is option D. The weight of the rocks above the mantle results in high pressure.

Explanation:

because of the impact of the weight of the overlying rock which bears down on it, in combination with the high temperature of the area where they are formed (about 100 miles beneath the surface)

8 0
4 years ago
Read 2 more answers
A man borrowed money at a bank $1400 at the rate o 3% for 3 years. a) Find the simple interest b) Find th total money repaid aft
zhannawk [14.2K]

Answer:

a) The simple interest is $126.

b) The total money repaid after 3 years is $1526.

Step-by-step explanation:

A man borrowed money at a bank $1400 at the rate o 3% for 3 years.

a) Find the simple interest

\longrightarrow{\sf{\red{S.I =  \dfrac{PRT}{100}}}}

  • → S.I = Simple Interest
  • → P = Principal
  • → R = Rate
  • → T = Time

Substituting all the given values in the formula to find the Simple Interest :

\longrightarrow{\sf{S.I =  \dfrac{PRT}{100}}}

\longrightarrow{\sf{S.I =  \dfrac{P \times R \times T}{100}}}

\longrightarrow{\sf{S.I =  \dfrac{1400 \times 3 \times 3}{100}}}

\longrightarrow{\sf{S.I =  \dfrac{14 \cancel{00}\times 3 \times 3}{1 \cancel{00}}}}

\longrightarrow{\sf{S.I = 14 \times 3 \times 3}}

\longrightarrow{\sf{S.I = 42 \times 3}}

\longrightarrow{\sf{S.I = 126}}

\star{\underline{\boxed{\pmb{\sf{S.I = \$126}}}}}

Hence, the simple interest is $126.

━━━━━━━━━━━━━━━━

b) Find the total money repaid after 3 years

\dashrightarrow{\sf{\pink{A = P + S.I }}}

  • → A = Amount
  • → P = Principal
  • → S.I = Simple Interest

Substituting all the given values in the formula to find the Amount :

\dashrightarrow{\sf{A = P + S.I }}

\dashrightarrow{\sf{A = 1400 + 126 }}

\dashrightarrow{\sf{A = 1526}}

\star{\underline{\boxed{\pmb{\sf{A = \$1526}}}}}

Hence, the total money repaid after 3 years is $1526.

\rule{300}{2.5}

3 0
2 years ago
- Explain why the concept of evolution is a Scientific Theory.
Anni [7]

Answer:

The theory of evolution basically serves to explain the biological evolution of living beings. The theory of evolution basically serves to explain the biological evolution of living beings. This results in the appearance of new species different from the previous ones.

6 0
4 years ago
Read 2 more answers
The Atmosphere is the shell of gasses that surround the Earth and is layered
Setler79 [48]

Answer:

I would say true, because

Explanation:

Earth's atmosphere has a layered structure. From the ground toward the sky, the layers are the troposphere, stratosphere, mesosphere, thermosphere, and exosphere. Another layer, called the ionosphere, extends from the mesosphere to the exosphere. Beyond the exosphere is outer space.

7 0
3 years ago
Other questions:
  • The wing of a penguin and the wing of an eagle are
    5·2 answers
  • As baleen whale numbers increase in the antarctic, you would expect the seal population to
    11·1 answer
  • The ways in which an organism interacts with its environment make up its
    14·1 answer
  • What’s the phenotype and probability
    13·1 answer
  • 10) Somatic cells of Drosophila simulans have a diploid chromosome number of 8. Drosophila are unusual among animals in that cro
    10·1 answer
  • True or false viruses can cause or help to prevent and treat disease
    14·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Assess Your Understanding
    7·1 answer
  • According to the food web diagram, what is the energy role of the bird? *
    9·1 answer
  • During unfavorable growth conditions, many protozoa can convert to a resistant, dormant stage called a/an
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!