1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
9

Hrips are insects that feed on rose pollen. Scientists noted that the thrips population increased in the spring and decreased dr

amatically during the summer. The researchers hypothesized that food abundance was the limiting factor for the population. Which of the following types of data would be most useful for the scientists to collect at regular intervals on a designated test plot of rose plants?
A. Amount of sunlight (hours/day)
B. Mean temperature (°C)
C. Density of rose pollen produced (g/m2)
D. Amount of pollen produced by each flower (g/flower)
Biology
1 answer:
Cerrena [4.2K]3 years ago
8 0

Answer: Density of rose pollen produced (g/m2)

Explanation:

The data that would be most useful for the scientists to collect at regular intervals on a designated test plot of rose plants is the density of rose pollen produced (g/m2).

It should be noted that the amount if sunlight or the mean temperature isn't the appropriate data that's useful in this case. Therefore, the correct option is D.

You might be interested in
When a substance abuse treatment program is acquired by another program, what is the the next course of actions?
Bezzdna [24]

When a substance abuse treatment program is acquired by another program, the next course of action is that <u>if any patients refuse consent to transfer, those records maybe destroyed or retained in compliance with the statue of limitations</u>

Explanation:

The Substance Abuse Confidentiality Regulations devised by the Substance Abuse and Mental Health Services Administration provides confidentiality to the patients undergoing a treatment program for substance abuse.  

Under this regulation, section 2.19 details and sets forth rules to follow when a program is acquired by another program.

This states that the program must either purge the identifying details of the patient from its records or destroy it until or unless the patient consents for the transfer of details or information in the records.

This condition can be exceptional in compliance with the statute of limitations and the records can be retained, like in case of any legal requirements .

4 0
3 years ago
A covalent bond is formed by
devlian [24]
Atoms sharing valance electrons
7 0
3 years ago
Simple animals are able to supply their cells with nutrients through diffusion and active transport across cell membranes becaus
goldfiish [28.3K]
This is because of B. Their cells are in direct contact with the environment.
6 0
3 years ago
Read 2 more answers
The movement of individuals out of a population
storchak [24]

Answer:

The Movement is called Migration.

Explanation:

Migration is an important component of Population growth. Migration is the movement of individual organisms into, or out of, a population.Migration affects population growth rate. Migration can be of two types- Immigration and Emigration.  Immigration can be described as the movement of individual into a population from other areas. This increases the size of a population and helps in growth. Emigration can be described as the movement of individual out of population.

3 0
3 years ago
Read 2 more answers
Name one characteristic that all protists have in common that separates them from monerans. Also what is a Plasmodium?
Alex777 [14]
Plasmodium, a genus of parasitic protozoans of the sporozoan subclass Coccidia that are the causative organisms of malaria. Plasmodium<span>, which infects red blood cells in mammals (including humans), birds, and reptiles, occurs worldwide, especially in tropical and temperate zones.

I hope my answer has come to your help. God bless and have a nice day ahead!


</span>
4 0
3 years ago
Other questions:
  • If a single mutation turns off the growth of some pairs of legs within an organism, what's most likely affected?
    10·1 answer
  • 4. How does the cell wall compared to the organelles?
    5·2 answers
  • How plastics are harmful for environment​
    5·1 answer
  • Why is it more common for birds to have nests with a few eggs rather than just one or a lot
    6·1 answer
  • 1.1.1 A young woman stepped on a dirty, rusty nail. The following diagrams
    7·1 answer
  • In the food web above, if new species of insect were introduced that fed primarily on plantains, how would the following populat
    10·2 answers
  • PLEASE HELP ITS DUE NOW
    9·1 answer
  • A human cell with 46 chromosomes undergoes meiosis. What will be the product at the end of meiosis?
    13·1 answer
  • Explain why plant cells do not "diminish" in overall size when they lose water.
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!