1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
9

Hrips are insects that feed on rose pollen. Scientists noted that the thrips population increased in the spring and decreased dr

amatically during the summer. The researchers hypothesized that food abundance was the limiting factor for the population. Which of the following types of data would be most useful for the scientists to collect at regular intervals on a designated test plot of rose plants?
A. Amount of sunlight (hours/day)
B. Mean temperature (°C)
C. Density of rose pollen produced (g/m2)
D. Amount of pollen produced by each flower (g/flower)
Biology
1 answer:
Cerrena [4.2K]3 years ago
8 0

Answer: Density of rose pollen produced (g/m2)

Explanation:

The data that would be most useful for the scientists to collect at regular intervals on a designated test plot of rose plants is the density of rose pollen produced (g/m2).

It should be noted that the amount if sunlight or the mean temperature isn't the appropriate data that's useful in this case. Therefore, the correct option is D.

You might be interested in
The body uses two types of amino acids: essential and nonessential. Which of the following statements about essential and noness
zlopas [31]

Answer:There are 11 nonessential amino acids.

Explanation:amino acids are monomers of proteins.proteins are made up of carbon,hydrogen, oxygen and nitrogen.there are 20 amino acids found in proteins.

Plants cam produce all the amino acids they need but animals cannot.

Essential amino acids are those that animals cannot produce by themselves and so need to obtain from their diet.there are 9 in numbers.

Non-essential amino acids are produced by the animals.they are not necessarily non-essential as the name indicates.they are 11 in numbers.

7 0
3 years ago
The covering of body surfaces and the lining of body cavities is composed of ________ tissue.
max2010maxim [7]
That is the Epithelial tissue
3 0
3 years ago
Methods can be taken to prevent from fungal disease​
Sidana [21]

Answer: Yes

Explanation:

4 0
3 years ago
Read 2 more answers
What is the answer :((( ?
amid [387]

The temperature of the water after adding the chemical.

8 0
3 years ago
A Sub-Saharan African widowed immigrant woman lives with her deceased husband's brother and his family, which includes the broth
Strike441 [17]

Answer:

The correct option is<em> D. Tell the surgeon that the brother-in-law will decide after explanation of the proposed surgery is provided to him and the widow</em>

Explanation:

In the Sub- Saharan region, the customary law allows the inheritance of wife and the culture of having more than one wife is also practised in this region. According to the law, the widow will become the inherited wife of her deceased husband's brother.

In those regions, the woman are suppressed and the regions are male dominant regions. The women have to obey men's command. Hence, it will more likely be that the brother- in- law will make the decision.

3 0
3 years ago
Other questions:
  • The absence of ________ leaves obligate anaerobes susceptible to killing by oxygen.
    13·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • A diseased cell is no longer able to produce proteins. Which cell structure is most likely malfunctioning?
    5·2 answers
  • Name 2 ways forelimbs are different than hind limbs.
    10·1 answer
  • Describe two events that are common to both mitosis and meiosis that ensure the resulting daughter cells inherit the appropriate
    13·1 answer
  • WILL MARK BRAINIEST
    15·1 answer
  • Which two samples are most likely to have come from the same person
    6·2 answers
  • I need help ASAP please!!!!!!!!!!!!!!
    8·1 answer
  • What happens when plates meet? (4 complete sentences minimum)
    9·1 answer
  • Which type of cell attacks a variety of unwanted cells and causes those cells to undergo apoptosis?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!